si:dkey-39n1.3

Ensembl ID:
ENSDARG00000058000
ZFIN ID:
ZDB-GENE-030131-6975
Description:
Novel protein similar to vertebrate centrosomal protein 350kDa (CEP350) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
CEP350
Human Description:
centrosomal protein 350kDa [Source:HGNC Symbol;Acc:24238]
Mouse Orthologue:
Cep350
Mouse Description:
centrosomal protein 350 Gene [Source:MGI Symbol;Acc:MGI:1921331]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41151 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1172 Nonsense Confirmed mutation in F2 line During 2018
sa9175 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38676 Nonsense Mutation detected in F1 DNA During 2018
sa15445 Nonsense Available for shipment Available now
sa31635 Essential Splice Site Available for shipment Available now
sa41150 Nonsense Mutation detected in F1 DNA During 2018
sa34350 Nonsense Mutation detected in F1 DNA During 2018
sa21227 Nonsense Available for shipment Available now
sa41149 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Essential Splice Site 29 3018 None 37
ENSDART00000132327 Essential Splice Site 29 1078 None 15
ENSDART00000146175   None 1836 None 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15121471)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14566815
GRCz11 8 14604520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTGTCCCTTCCCAGCCTCCCTTTGCTGGGCAAGACAACAGGAGAGG[T/C]TTGTACAGCTGTGTCACTCTATCAGTCCCTCCAAAAGTTTGCGAGTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1172
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 1354 3018 18 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 173 1836 4 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15098525)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14543869
GRCz11 8 14581574
KASP Assay ID:
554-1082.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGATCAACCAGCAGGCTGAGGCCGCACGACACACAGCTGAAACAGCA[C/T]GACACATTAAAGAAGTGAGACGTTATTACTCTTAAAACATTTGTATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Essential Splice Site 1625 3018 None 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Essential Splice Site 443 1836 None 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15095223)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14540567
GRCz11 8 14578272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGAGAAGACCAAGGCTGAAGTGGCCTGGCTGGAGCACCAGAAGAGG[C/T]AGGCCAAATCATTCATTTTATGAGTTCTCTTTGACTATATGAACCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 1670 3018 25 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 488 1836 11 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15093023)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14538367
GRCz11 8 14576072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGCGGAGATTAAACGACTCCAGGAGGCCAATAAAGCAGCGAGAAGA[G/T]AGAGACAGCTGCTCCTCAAACAGCAGGAGGAGATTGAGAGAATGAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 1677 3018 25 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 495 1836 11 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15093002)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14538346
GRCz11 8 14576051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGAGGCCAATAAAGCAGCGAGAAGAGAGAGACAGCTGCTSCTCAAA[C/T]AGCAGSAGGAGATTGAGAGAATGAGACACACAACCCTCAAACTCAAAGAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Essential Splice Site 1999 3018 30 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Essential Splice Site 817 1836 16 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15083510)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14528854
GRCz11 8 14566559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGAGCGACTAAAGGCACAGGAAGCAAGTTTGCTGAAACAATTGGAG[G/A]TCAGCAACCTGCGCTTTACATATTCACTTGTTTCTGTGCAGCAATATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 2356 3018 33 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 1174 1836 19 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15082093)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14527437
GRCz11 8 14565142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCAATGGCAACTTCCAAACTGAAAGTCGACCAGACCTCAATAGCCTT[G/T]GAAGAGGCTCTAAAGACGTCATCGGCCCTTCACCACAGCCACAAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 2368 3018 33 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 1186 1836 19 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15082057)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14527401
GRCz11 8 14565106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAATAGCCTTGGAAGAGGCTCTAAAGACGTCATCGGCCCTTCACCA[C/T]AGCCACAAGTGCCAATCTTGCCAATAAAGGACGAATTGCCAAGCTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 2513 3018 33 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 1331 1836 19 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15081622)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14526966
GRCz11 8 14564671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATCTGACCTAGATTTATATCCTGAGGCCAGAGAGCCTTTGCGTGAG[C/T]AAGGCAAGCCATTGGAACTCAACATCAAGCAGCTTTCTACTGGGCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090254 Nonsense 2960 3018 36 37
ENSDART00000132327   None 1078 None 15
ENSDART00000146175 Nonsense 1778 1836 22 23

The following transcripts of ENSDARG00000058000 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15078475)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14523819
GRCz11 8 14561524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAACAGACTGGCAAAAAATGATCAAATTTGGACGGAAAAAGCGAGAC[C/T]GAGTAGACCACATCCTAGTAAGTGAACTTCACATTATTATCTTCATCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link