Gene Regulation

Gene Regulation ▶ MPRA Library Construction (SNPs)

FASTA sequence

Enter sequence: >sequence1chr1:42990-43041,testest ACAGATTAGTCAGTACGGCTAGCTAGCTACGTCTATATTATAGCGATACGGG
or upload file

SNPs

Enter your SNPs (VCF Format): 1 42991 rs43434 T G 1 43030 rs121212 A G

Options

Make Snp Combinations?
Barcode length
Minimum barcode GC content (%)
Maximum barcode GC content (%)
Barcode edit distance
Number of barcode per sequence

Restriction sites

Restriction site 1
Restriction site 2

Adapter sites

Adapter site 1
Adapter site 2

Pick the order of the elements

Information: Barcode Background Rest. site 1 Rest. site 2 Adpt. site 1 Adpt. site 2

Instructions

This page allows the user to synthesize oligonucleotides for MPRA experiments to study the effects of SNPs. The user can select to include or exclude combinations of SNPs when designing MPRA experiments.

Parameters

Enter FASTA sequences: The Fasta sequences as text.
Upload FASTA sequences: The Fasta sequences as a text file.
Enter your SNPs (VCF Format): SNPs in VCF format (as text).
Make Snp Combinations?: Create all combinations of SNPs to be substituted to sequences.
Barcode length: The size of the barcode specified
Minimum barcode GC content (%): The minimum amount (in percent) of GC content in each of the barcodes
Maximum barcode GC content (%): The maximum amount (in percent) of GC content in each of the barcodes
Barcode edit distance: The Levenshtein distance between each barcode. The default is 2.
Number of barcodes per sequence: This specifies the number of barcodes inserted per sequence (replicates).
Restriction sites: The ability to add upto 2 restriction sites into the final product.
Adapter sites: The ability to add upto 2 adapter sites into the final product.
Ordering: Allows the user to order the constituent parts therefore providing flexibility in the design of the experiment.

Result page

The result page (plain text view) displays the synthesized oligonucleotides in FASTA format. The description line (header) has information about the options chosen by the user during submission. A header is composed of one or more DESCRIPTORs and each DESCRIPTOR is composed of a LABEL and INFO. The descriptors are delimited by a |, i.e. a "pipe".

The format of the FASTA header for each sequence is shown below. Note that the order of the DESCRIPTOR in the header is not significant.

> <LABEL> - <INFO> | <LABEL> - <INFO> | <LABEL> - <INFO> | ...

The LABEL is one of the options as shown below and INFO is either a number or a word which describes the LABEL in more detail.

Label types:

<MOTIF>: Name of SNP.
<NUCLEOTIDE>: REF/ALT.
BARCODE: The variant of the same sequence
RESTRICTION: This is the restriction site put by the user
ADAPTER: The presence of the adapter sequence of the specified number
DUPLICATE_RESTRICTION_SITES: The restriction site which has multiple copies present.