CAF is a text format for describing sequence assemblies. It is acedb-compliant and is an extension of the ace-file format used earlier, but with support for base quality measures and a more extensive description of the Sequence data.
[The Wellcome Trust Sanger Institute]
CAF is intended to be sufficently comprehensive that any assembly engine/editor such as Phrap, Consed, Gap, Acembly, FAK etc can derive all the information it needs from the CAF file without reading any other data, (except for trace information which is still held in SCF files). The eventual aim is to be able to freely convert between CAF and any other format so that different assembly programs can be combined. This aim is still some way off because of incompatibilities between these programs. Currently it is possible to convert to and from Phrap, FAK, and into GAP (the reverse is possible with some loss of information).
CAF Version 2 supports some additional tags (Insert_size, Ligation_no) for reads. More importantly, it has support for describing partially-assembled groups of contigs. The basic idea is that an Is_assembly Sequence object is an ordered set of Is_group Contig Group objects, listed by the Group_order tag. In turn, each Contig group is an ordered set of contigs listed by the Contig_order tag. It is thus easy to manipulate groups if contigs (eg that are believed to be adjacent) without having to use absolute coordinates.
In CAF files, Comments are any text preceded by //
CAF supports three object types, Sequence, DNA and BaseQuality. The Sequence type is the most complex. All base coordinates start at position 1 (NOT 0). These are the important Sequence attributes (others are available in the CAF acedb model but are not currently used by any processing module).
Sequence : "Name" // Name of the Sequence
Is_read | Is_contig | Is_group | Is_assembly // Type
Padded | Unpadded // State
ProcessStatus "State" "Text" // Reads only: Asp pass or failure, with reason.
// "State" can be:
// PASS,
// SVEC (completely seq vector),
// QUAL,(poor trace quality),
// CONT (contaminant, eg E.coli)
Asped "Date" // Reads only: Date processed
Dye Dye_terminator | Dye_primer // Reads only: Chemistry
SCF_File "Filename" // Reads only: Name of SCF file containing trace data
Primer Unknown_primer | Universal_primer | Custom "Oligo" // Reads only: primer type,
// including oligo sequence if Custom
Template "Template" // Reads only: Template name
Insert_size x1 x2 // Predicted range [x1,x2] of insert size
Ligation_no "Text" // THe Ligation number (ie library identifier) for the read
Strand Forward | Reverse // Reads only: forward or reverse strand
Seq_vec "Type" x1 x2 "Text" // Sequencing vector from position x1 to position x2 inclusive
// "Type" is redundant, set to SVEC by default.
Clone_vec "Type" x1 x2 "Text" // Cloning vector from position x1 to position x2 inclusive
// "Type" is redundant, set to CVEC by default.
Clipping "Type" x1 x2 "Text" // Clipping from position x1 to position x2 inclusive
GoldenPath "Read" x1 x2 // Contigs only: Phrap Golden path:
// Use "Read" between contig coords x1, x2 inclusive
Tag "Type" x1 x2 "Text" // General Tag on interval [x1,x2] (used in GAP)
Assembled_from "Read" s1 s2 r1 r2 // Contigs only: Alignment of Read to contig.
// Interval [r1, r2] in the read align with [s1,s2] in contig.
// If s1 > s2 then align the reverse complement of [r1,r2] with [s1,s2].
Align_to_SCF s1 s2 r1 r2 // Reads only: Alignment of Read to original SCF base-calls.
// Similar to Assembled_from
Group_order Group p1 // Assemblies only: defines Group to be at group position p1 within assembly
Contig_order Contig q1 // Groups only: Defines Contig to be at relative position q1 within group
DNA
DNA : "Name" // Name of sequence
ACGTGCGG...... // The sequence: Use ACGT, N for unknowns, - for pads.
BaseQuality
BaseQuality : "Name" // Name of sequence
0 12 13 90 ... // Base qualities. These must be positive integers
// between 0 and 99 inclusive. If the Base Quality is present
// in must be the same length as the DNA
The alignement of a reading to the contig can be Padded or Unpadded. Padded means that gaps ("-") have been inserted where required in both contig and aligned readings so that there is a 1-1 correspondence between the aligned DNAs. In a Padded assembly there is exactly one Assembled_from line for each aligned read in a contig, and the DNA objects contain "-" padding characters.
In an unpadded alignment all the pads are removed from the DNA objects and there are multiple Assembled_from lines for each reading in a contig. However, Within each Assembled_from line there is a 1-1 correspondence between the (possibly reverse-complemented) read interval [r1,r2] and the contig interval [s1,s2].
Some applications (eg auto-edit, gap) required padded alignments. Others require unpadded. The programs caf_pad and caf_depad allow one to move transparently between padded and unpadded states, without loss of information (well, almost - columns of pads are removed). Note that in a padded alignment with BaseQuality information it is necessary to attach a quality value to each pad to keep the lengths equal. By convention this is 1, but this may change.
[Another sequence state not considered here is "Loose". A Loose aligment of a read to a contig just says that [r1,r2] in the read aligned somehow with [s1,s2] in the contig, possibly with the inclusion of gaps.]
Sequence : hh26e2.s1 Is_read Unpadded SCF_File hh26e2.s1SCF Template hh26e2 Dye Dye_primer Primer Universal_primer Strand Forward ProcessStatus PASS Align_to_SCF 1 171 1 171 Align_to_SCF 172 595 173 596 Tag DONE 119 119 "AUTO-EDIT: replaced C by t at 119 (double, isolated, strong)" Tag DONE 145 145 "AUTO-EDIT: replaced N by t at 145 (double, compound, strong)" Tag DONE 146 146 "AUTO-EDIT: replaced T by g at 146 (double, compound, strong)" Tag DONE 171 171 "AUTO-EDIT: deleted G at 171 (double, isolated, strong)" Tag DONE 193 193 "AUTO-EDIT: replaced A by c at 193 (double, isolated, strong)" Seq_vec SVEC 1 24 "M13mp18" Clipping QUAL 56 117 Clipping ECLIP 46 241 DNA : hg02b9.s1 CGCTGCAGGTCGACTCTAGAGGCTCCCCTGAGCCGCTGTGGATTGAGGAGGTGAGGCGTG AGGAGGTGAGGAGTGAGAAGGTCAGGAGGGACGGAGGTGACGAGTGAGGAGGCGAGGTGA GGCGTTAGGAGGTGGGGAAGTCAGGAGGTGAGTCAGGACCTGAGGAGTCAGGGGGTGAGG AGTTAGGTGGTCAGGAGTCAGGAGGTGACGAGTTAGGAGGTGGGGCAAGTGAGGAGGTGA GGAGTGAGGACATGACGAGTGAGTAGGTGAGGAGTCACGGGGGTCAGGAACGTGACAAGG TTTCGACGTCCAATCCATCGTTCCAGGACCTTCCAGCTTGTGTCCTCTGACAGTGACCTC ACCTGCCAGGTCTGGCCCTCCTGGCAGGCAAGAGGGCCGGCCGTGGGGGCGGTGGAGGGG GTGGCCTCCCAGGGGTGAAGTCGGGGGTTGGGCTCCGACCGTCTGGCCACCGTTGGGGGT GAGCCCGGTGGGAGTGTTGGGGGGG BaseQuality : hg02b9.s1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 15 0 0 0 0 0 0 18 17 17 0 18 0 0 0 0 0 0 0 0 0 0 19 0 15 0 0 0 0 18 17 24 22 18 21 18 18 0 15 15 21 23 21 0 0 0 0 0 21 0 0 0 16 19 23 21 0 0 0 0 0 21 21 22 0 0 0 0 0 0 0 0 0 0 0 0 18 18 23 22 23 23 15 15 17 0 23 15 21 22 21 21 21 25 19 23 19 30 18 18 18 27 21 0 0 0 0 0 0 25 18 22 15 0 0 0 15 0 21 17 0 0 0 0 0 18 0 0 0 16 16 21 16 0 0 0 0 0 16 16 0 0 0 0 0 0 15 15 0 0 15 15 0 0 0 0 0 0 0 18 18 21 20 20 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 25 19 19 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 20 0 0 0 0 0 0 0 0 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 0 0 0 0
This is a padded reading, with standard dye primer chemistry with universal primer. The base at position 172 in the SCF trace have been deleted, hence the Align_to_SCF maps read position 171 -> trace position 171, and read position 172 -> trace position 173.
Positions 1 to 31 are sequencing vector Positions 56 to 117 are high quality, according to the base-quality measures Positions 46 to 241 align well with the contig consensus
The read has been autoedited (hence the deleted base) and tags attached to the edited bases.
The corresponding contig is:
Sequence : Contig3 Is_contig Unpadded Assembled_from hg82b3.s1 7635 7677 1 43 Assembled_from hg82b3.s1 7678 7697 45 64 Assembled_from hg82b3.s1 7698 7703 66 71 . . . Assembled_from hg02b9.s1 7968 7878 1 91 Assembled_from hg02b9.s1 7877 7745 93 225 Assembled_from hg02b9.s1 7744 7694 227 277 Assembled_from hg02b9.s1 7693 7607 279 365 Assembled_from hg02b9.s1 7606 7603 367 370 Assembled_from hg02b9.s1 7601 7599 371 373 Assembled_from hg02b9.s1 7598 7584 375 389 Assembled_from hg02b9.s1 7583 7570 391 404 Assembled_from hg02b9.s1 7569 7470 406 505 . . .
So that reverse-complemented read hg02b9.s1 positions [1,505] align to [7470,7968] (This is the full Phrap alignment, ie not clipped back). The individual unpadded subsections align as indicated, eg [1,91] with [7878,7968].
After padding the alignment (with caf_pad) we have
Sequence : hg02b9.s1 Is_read Padded SCF_File hg02b9.s1SCF Template hg02b9 Dye Dye_primer Primer Universal_primer ProcessStatus QUAL Align_to_SCF 1 3 1 3 Align_to_SCF 5 20 4 19 Align_to_SCF 22 37 20 35 Align_to_SCF 39 46 36 43 Align_to_SCF 48 48 44 44 Align_to_SCF 51 74 45 68 Align_to_SCF 76 80 69 73 Align_to_SCF 82 94 74 86 Align_to_SCF 96 108 87 99 Align_to_SCF 110 121 100 111 Align_to_SCF 123 128 112 117 Align_to_SCF 130 199 118 187 Align_to_SCF 201 267 188 254 Align_to_SCF 269 274 255 260 Align_to_SCF 276 278 261 263 Align_to_SCF 280 281 264 265 Align_to_SCF 283 284 266 267 Align_to_SCF 286 290 268 272 Align_to_SCF 292 292 273 273 Align_to_SCF 294 308 274 288 Align_to_SCF 311 312 289 290 Align_to_SCF 314 317 291 294 Align_to_SCF 319 334 295 310 Align_to_SCF 336 336 311 311 Align_to_SCF 338 371 312 345 Align_to_SCF 373 376 346 349 Align_to_SCF 378 398 350 370 Align_to_SCF 400 442 371 413 Align_to_SCF 444 444 414 414 Align_to_SCF 446 446 415 415 Align_to_SCF 448 468 416 436 Align_to_SCF 470 534 437 501 Align_to_SCF 536 539 502 505 Seq_vec SVEC 1 30 "M13mp18" Clipping QUAL 2 537 DNA hg02b9.s1 539 Strand Forward Clone 4B5 Asped 25-Mar-1996 DNA : hg02b9.s1 CGC-TGCAGGTCGACTCTAG-AGGCTCCCCTGAGCCG-CTGTGGAT-T--GAGGAGGTGA GGCGTGAGGAGGTG-AGGAG-TGAGAAGGTCAGG-AGGGACGGAGGTG-ACGAGTGAGGA G-GCGAGG-TGAGGCGTTAGGAGGTGGGGAAGTCAGGAGGTGAGTCAGGACCTGAGGAGT CAGGGGGTGAGGAGTTAGG-TGGTCAGGAGTCAGGAGGTGACGAGTTAGGAGGTGGGGCA AGTGAGGAGGTGAGGAGTGAGGACATG-ACGAGT-GAG-TA-GG-TGAGG-A-GTCACGG GGGTCAGG--AA-CGTG-ACAAGGTTTCGACGTC-C-AATCCATCGTTCCAGGACCTTCC AGCTTGTGTCC-TCTG-ACAGTGACCTCACCTGCCAGG-TCTGGCCCTCCTGGCAGGCAA GAGGGCCGGCCGTGGGGGCGGT-G-G-AGGGGGTGGCCTCCCAGGGGT-GAAGTCGGGGG TTGGGCTCCGACCGTCTGGCCACCGTTGGGGGTGAGCCCGGTGGGAGTGTTGGG-GGGG BaseQuality : hg02b9.s1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 17 0 0 0 0 0 0 15 0 0 0 0 0 0 18 17 17 0 18 0 0 1 0 0 0 0 0 1 0 0 0 19 0 15 0 0 0 0 18 17 24 1 22 18 21 18 18 0 15 15 21 23 21 0 0 1 0 0 0 21 0 0 0 16 19 23 21 0 1 0 0 0 0 21 21 1 22 0 0 0 0 0 0 0 0 0 0 0 0 18 18 23 22 23 23 15 15 17 0 23 15 21 22 21 21 21 25 19 23 19 30 18 18 18 27 21 0 0 0 0 0 0 25 18 22 15 0 0 0 15 0 21 17 0 0 0 0 0 18 0 0 0 16 16 21 16 1 0 0 0 0 0 16 16 0 0 0 0 0 0 15 15 0 0 15 15 0 0 0 0 0 0 0 18 18 21 20 20 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 25 19 19 1 0 0 0 0 0 0 1 0 0 0 1 0 16 1 0 0 1 0 0 15 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 20 0 1 0 0 0 0 0 0 0 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 1 0 0 0 0
Note how the Align_to_SCF is now much more complex since it has to take into account all the pads inserted into the dna. The DNA contains pads "-" and the BaseQuality data fake values "1" at each pad position. The alignment of the read to the contig is now much simpler however:
Sequence : Contig3 Is_contig Padded . . Assembled_from hg02b9.s1 8618 8080 1 539 . .
So positions [1,539] in the padded (reverse-complemented) read align with [8080,8616] in the padded contig.
Sequence objects in the CAF file are used to represent both read and contigs (constructed during sequence assembly from reads).
| Field | Description |
|---|---|
| Is_read | The sequence respresents a reading |
| Is_contig | The sequence respresents a set of aligned reads |
| Is_vector | The sequence respresents an artificial sequence |
An assembly can be in either a padded or unpadded state. In the padded state, padding characters are added to the contig sequence and the reads so that the reads align with one another perfectly. In the unpadded state, the alignment between reads and the contig is described fully.
| Field | Description |
|---|---|
| Padded | The sequence is padded |
| Unpadded | The sequence is unpadded |
Features identified within sequences are annotated using one of the following four fields. In each case, Method is either the name of a program, or some generic name describing the method. We currently use the name of the GAP4 (Bonfield et al, 1996) tag id. The feature is considered to cover bases From through To in the Sequence. Comment is optional. If more than one word, the comment should be surrounded by double quotes.
| Field | Attributes | Description |
|---|---|---|
| Clone_vec | Method From To Comment | Location of Cloning vector. |
| Seq_vec | Method From To Comment | Location of Sequencing vector. |
| Clipping | Method From To | High quality bases. |
| Tag | Method From To Comment | Some arbirary feature. |
| Field | Attributes | Description |
|---|---|---|
| Sequencing_vector | Vector_name | The name of the sequencing vector used. |
| Template | Template_name | The name of the DNA template from which the sequence was determined. |
| Insert_size | From To | Minimum and maximum size estimate of insert of DNA template. |
| SCF_File | File_name | The name of the SCF file for this reading. |
| Base_caller | Base_caller_name | The name of the base calling software used to generate read. |
| Stolen | Comment | The read was not originally sequenced for the clone |
| Staden_id | Integer | The internal read number from the Staden GAP database (gap2caf). |
| Asped | Date | The date the read was sequenced/pre-processed. |
| ProcessStatus | Text | Preprocessing status (PASS or FAIL). |
| Align_to_SCF | ReadFrom ReadTo SCFFrom SCFTo | The alignment between the read and the original base calls |
Information about the sequencing chemistry used to generate the read is included. One of the following must be specified.
| Field | Description |
|---|---|
| Dye_primer | The read was sequenced using Dye primer chemistry |
| Dye_terminator | The read was sequenced using Dye terminator chemistry |
Orientation of the read with respect to the template is specified by one of the following:
| Field | Description |
|---|---|
| Forward | The read is on the Forward strand of the template |
| Reverse | The read is on the Reverse strand of the template |
The location of the read with respect to the insert is specified by one of the following:
| Field | Attributes | Description |
|---|---|---|
| Universal_primer | Either a forward or reverse universal primer was used. | |
| Custom | Primer_name | A custom primer was used. The name is optional. |
The alignment of the reading to the contig is described in lines:
| Field | Attributes | Description |
|---|---|---|
| Assembled_from | ContigFrom ContigTo ReadFrom ReadTo | The alignment between the contig and the read |
This document describes the functions and usage of a suite of programs for manipulating CAF (Common Assembly Format) sequence assemblies. All the software was written by Simon Dear, Dave Hodgson and Richard Mott at the Sanger Institute.
All the programs in this section act as filters on single CAF files and so can read and write CAF data on stdin and stdout:
program < input > output
or by the switches
program -caf input -out output
Other command-line options are available with individual applications. Boolean switches can be tuned off by prefixing them with "no", eg -clip and -noclip. Brief online help is available for most programs by typing
program -help
Some programs produce dignostics on stderr.
usage: cafcat [-summary] [-sanitise] [-verbose] [-check]
-caf input | < input -out output | > output
Options:
-reformat switch [ false ]
-verbose switch [ false ]
-check switch [ false ]
-summary switch [ false ]
-help switch [ ]
-caf Readable File [ ]
Reads and writes a CAF assembly. Useful for consolidating a fragmented CAF file. The CAF database is also sanitised before being printed, ie contigs with no readings are removed, together with references in the Golden_path to non-existent readings.
If -summary is set then a summary of the assembly is written to stdout instead of the caf file.
If -check is set then the assembly is checked for consistency, but is not written to stdout. If -verbose is also set then errors are displayed to stderr. This is useful for checking whether an assembly is consistently padded/unpadded. The exit status is 0 if the assembly is consistent, non-zero if some kind of anomaly was detected. Note that sometimes the checking is too picky and will choke on legal but bizarre assemblies. -reformat is an obsolete switch used to convert ace-files to caf files.
caf_pad -caf input | < input -out output | > output
Pads an unpadded CAF assembly.
caf_depad -caf input | < input -out output | > output
Depads a padded CAF assembly. These programs are almost inverses of each other except that columns consisting entrely of pads are deleted by caf_depad. If you are unsure of the pad-state of a CAF file it is safe to use these programs as they check the state before doing anything. Note however that if they encounter a problem (eg a contig containing reads in mixture of pad states) they will either leave the assembly untouched or exit with a non-zero error code.
The pad-state of a Sequence object is defined by the attribute Padded or Unpadded. If you have reason to suspect there is something wrong with an assembly you can check it with cafcat -check -verbose
caf2phrap -caf input | < input -fasta output [-fofn file]
[-clip|-noclip] [-high=0] [-low=0] -fasta fastafile
[-qual qualfile ] [-cafout caffile ]
Options:
-high integer [ 0 ]
-low integer [ 0 ]
-mask integer [ 0 ]
-fofn Readable File [ ]
-contigs switch [ false ]
-reads switch [ true ]
-fasta Writeable File [ ]
-qualfile Writeable File [ ]
-qual switch [ true ]
-clipping text [ QUAL ]
-svclip switch [ true ]
-cvclip switch [ false ]
-failures switch [ false ]
-tag_mask text [ ]
-help switch [ ]
-caf Readable File [ ]
Splits a CAF file into three output files suitable as inputs to Phrap. Given a file of read names, via the -fofn file switch, caf2phrap creates a fasta-format sequence file for those readings, a file of base quality measures (if they exist in the CAF input), and a CAF file corresponding to the entries in fofn which exist in the input. If -fofn is omitted or the corresponding file will not open then all the reads are processed.
The name of the fasta sequence file is defined by the -fasta output switch. If the switch -qual is true (which it is by default) then quality data are written out to the file specified by the -qualfile switch or derived by appending ".qual" to the file specified by -fasta If base_quality exists for a sequence then it is dumped out. If base-quality does not exist then it is faked from clipping data according to the [comma-separated list of] Clipping tags given by the -clipping switch, by default "QUAL". High quality regions are given quality "high" (1 by default), otherwise they are "low" (0 by default). If a sequence has no base quality or clipping tags then it is given the base quality 0 The output CAF file is named by -cafout if this argument is supplied.
If base-quality data for a sequence does not exist then it is faked, with upper-case nucleotides having the value set by -high (default 0) and lower-case by -low (default 0). All quality values less than -mask are set to 0.
If -svclip is set (on by default) then portions of sequence corresponding to sequencing vector (defined via the Seq_vec tags in the CAF file) are x-d out and the corresponding base quality measures set to 0.
If -cvclip is set (off by default) then portions of sequence corresponding to cloning vector (defined via the Clone_vec tags in the CAF file) are x-d out and the corresponding base quality measures set to 0.
If -tag_mask is present it must consist of a [comma-separated] list of Tag names. Portions of sequence corresponding to these Tag types are x-d out and the corresponding base quality measures set to 0. By default -tag_mask is empty
If -reads is set (on by default) then all Sequence objects that are readings are output.
If -contigs is set (off by default) then all Sequence objects that are contigs are output.
If -failures is set (off by default) then failed reads are output.
caf2phrap requires unpadded data.
cafmerge -caf1 input1 -caf2 input2 -out outfile | > outfile
Merges the output of phrap2caf back with the CAF-file produced by caf2phrap, to generate a CAF file with the original unpadded DNA for the readings, suitable for further processing.
Sequence attributes in input1 are overwritten by the corresponding attributes in input2.
nd_clip [-clip type ] [-vector|-novector] [-fail|-nofail]
-caf input | < input -out output | > output
Options
-clip text [ ]
-svector switch [ false ]
-cvector switch [ false ]
-fail switch [ true ]
-warn switch [ false ]
-logfile Writeable File [ ]
-help switch [ ]
-caf Readable File [ ]
Does clipping on assembled readings. If -clip type is set to a valid clip type (Corresponding to the CAF Clipping QUAL tag) then reads are clipped back accordingly. Eg if a reading is aligned to a contig between read positions 25 and 404, but its QUAL clip points are 45 to 500 then the read becomes aligned over 45 to 404.
A log file is written if -logfile defineds a writable file.
If -svector is set (on by default) then reads are also clipped for sequencing vector(as defined by Seq_vec tags) tags). E.g. if the previous reading has sequencing vector between 375 and 780 then the read is clipped to 45,375.
If -cvector is set (off by default) then reads are also clipped for cloning vector (as defined by Clone_vec tags) tags).
If -fail is set then reads with the Failure attribute set are deleted.
nd_clip requires unpadded data (but will depad on the fly if the input is padded).
ne_clip [-match=1] [-mismatch=20] [-gap=20] [-neutral=2]
[-original|-nooriginal] -caf input |
< input -out output | > output
Options:
-bad float [ 0 ]
-debug text [ ]
-logfile Writeable File [ ]
-match integer [ 1 ]
-mismatch integer [ -20 ]
-gap integer [ -20 ]
-neutral integer [ -2 ]
-original switch [ false ]
-extend switch [ true ]
-help switch [ ]
-caf Readable File [ ]
Clips back readings to where they best align with the contig consensus. If a region becomes single-stranded as a result then readings are extended out again appropriately.
The algorithm assumes the readings are already aligned to the consensus in a sensible fashion (as is the case with Phrap output) as far out as is possible. These alignments define "lax" clip points for the reads. Using strict mismatch and indel penalties the alignment of each read is re-scored, and the maximal matching segment determined, producing "strict" clip points. Then all reads are clipped back to their strict clip points. Regions which become zero- or single- stranded as a result are recovered by extending neighbouring reads back as far as required, up to their lax clip points. If -noextend is set then reads are NOT extended back.
The penalties for a match, mismatch and gap are set via the obvious switches. -neutral determines the penalty for matching to an N.
If -original is set then the contig sequence is used for alignment rather than the majority-vote consensus.
-bad controls the minimum percent identity a read must have with the consensus in order not be thrown out.
A log file is written if -logfile defineds a writable file.
ne_clip requires a padded assembly (but will pad on the fly).
np_edit [-scf|-noscf] [-bad=85] [-logfile file] -caf input |
< input -out output | > output
Options:
-scf switch [ false ]
-verbose switch [ false ]
-bad float [ 85 ]
-depth integer [ 4 ]
-max_run integer [ 4 ]
-max_stack integer [ 4 ]
-dump switch [ false ]
-scfcache integer [ 0 ]
-stlouis float [ -1 ]
-logfile Writeable File [ ]
-help switch [ ]
-caf Readable File [ ]
-out text [ stdout ]
nd_edit -caf input | < input -out output | > output
Options:
-verbose switch [ false ]
-skip switch [ true ]
-show_case switch [ true ]
-help switch [ ]
-caf Readable File [ ]
-out Writeable File [ ]
np_edit proposes edits to the reads to generate a consensus. nd_edit disposes of the edits and creates tags indicating where an edit has been made. Normally np_edit pipes its output straight into nd_edit. See the separate web page <> for more information about how the auto-editor works.
np_edit examines the alignment of reads to the consensus to find places of disagreement between aligned readings. It then examines the trace data in SCF files if available, to determine whether it is safe to make an edit. It currently will only edit down to the majority vote consensus, unless there is a tie when it will consider all consensuses. If -logfile is set then a logfile is created with explanantory info, including which reads were rejected and how many edits were made in each contig.
Trace data are used if the switch -scf is set. If the trace data are not in the current directory then the environment variable RAWDATA should be set to a colon-separated list of directories to search. The name of the SCF file corresponding to a reading is defined by the CAF Sequence attribute SCF_File.
np_edit throws out all readings with less than 85% identity (or to whatever -bad is set ) with the majority-vote consensus.
np_edit will not make an edit if it occurs as part of a horizontal run of edits longer than that defined by -max_run, or vertically more than -max_stack
The other options are probably not interesting.
Options for nd_edit (the disposer):
-skip (on by default) omits reads thrown out by np_edit as being misaligned. -show_case (on by default) down-cases edited bases in the consensus.
caf2gap -ace=input -project=PROJECT -version=version -caf=1 gap2caf -ace=output -project=PROJECT -version=version -caf=1
Convert CAF file to a GAP database and back. The transfer is lossy at the moment - alignment, tag and vector clip information is preserved, other data is lost.
phrap2caf < acefile > caffile
Is a perl program that massages the ace-file output of phrap into CAF format. The changes are mostly syntactical, except that reads which overhang the ends of contigs are trimmed back.
caf_phrap -project project -fofn files -out outfile
-tmp dir -clean -extend
caf_phrap is a perl script that runs Phrap on a CAF database and massages the output back into CAF format. It is assumed that the script is run from within the project directory. caf_phrap looks for the file ./CAF/caf.raw (see update_caf), and runs caf2phrap on this file to generate the phrap input files. Then Phrap is run and the results merged back by running phrap2caf and cafmerge. The contig base quality data are also appended to the output. The switch -fofn gives a file of read names to use. If this is omitted then all the reads in caf.raw are utilised. -tmp is the name of the temp directory to use for writing intermediate files. By default this is ./Phrap. If -clean is set then the temp files are deleted at the end.
update_caf -clean
Updates the CAF database by searching the current directory for new experiment files (e.g. produced by Asp). The CAF database always resides in the file ./CAF/caf.raw. If this does not exist it is created. If it exists then any new exp files are converted to CAF format (by exp2caf) and appended to caf.raw. If -clean is set then the database is deleted and recreated. update_caf uses indir to determine what are the experiment files.
cafextend < input > output
A perl script that looks for holes in the Phrap assembly and tries to extend readings to cover them using the Golden_path information.
phrap2gap is a perl script that runs Phrap on a CAF database, then clips, autoedits and post-processes the result and finally generates a GAP database.
DNA : 22ak93c2.r1t GTCGCnCATAAGATTACGAGATCTCGAGCTCGGTACCCTTCAAGCGATTCTCCTGCCTCA GCCTCCCGAGTAGCTGGGATTATAGACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTG TATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAGCTCCTGACCT AGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAGGA GGAAGGGATCCTAgAAAAACAGAGACAAGGCCAAACATGGTAgCTCACACCTGTAATCCC AnCACTTTGGGAGGCCagTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCACCCTGGC CAACATGGTGTAACACCTGCTCTCCTAAAATTAAACAAAATTTCATGGTTTGCGTGGGCC GTCTTGTCTCATCACTTCACTCCTGAGGGCCGGCGCCGGAAAGATATCTTGATCTGCGGC GCTCCGACCGTTTTCTTTAAACCTTACAACTCCCGACCTCCTCGCCTATCCTCCCTAAAT CCTCGCCAGGCTCGCCTGCTTCAGCCACTCTTTCCTTCGCACCCTCCCCTCTCTTCAATA TACTTCACCCGCCCATCCTTCACGCCGGCACGTATCCAATCTCTTCTTATCTTTCCGTAT CCAAnTCCCTTCTCCCTCTGCCGCGACCTTCGCCATCCCTCTGCGCGTCCTCTTCC BaseQuality : 22ak93c2.r1t 4 4 8 4 4 4 4 4 4 4 4 4 6 8 17 21 14 7 6 6 6 7 7 6 8 14 16 21 15 20 20 24 26 21 18 18 14 14 19 23 10 8 8 15 20 16 29 26 34 29 39 29 31 29 31 34 32 27 27 25 19 19 24 31 33 36 34 34 34 26 27 22 32 32 36 28 28 15 15 15 28 28 34 30 12 12 22 27 31 31 31 31 31 23 24 27 21 24 24 29 27 27 27 34 34 36 38 38 38 36 36 40 36 37 38 45 45 36 34 33 31 31 34 34 33 33 28 28 27 23 24 11 11 10 10 18 25 21 20 17 17 17 20 15 24 18 24 26 23 23 18 20 25 23 30 30 30 33 33 37 37 32 37 37 32 45 35 37 37 37 40 36 49 49 36 36 34 33 20 15 9 9 8 7 12 22 21 28 28 30 33 36 36 36 34 31 31 25 31 28 26 26 24 20 17 9 11 8 9 10 23 23 31 23 23 15 9 9 15 33 26 33 33 31 25 25 22 31 24 23 12 10 12 11 9 8 9 7 7 8 8 9 18 12 9 9 18 20 26 31 21 21 9 8 8 11 13 21 21 23 15 15 15 15 15 17 17 9 7 9 19 20 21 21 25 25 25 25 25 23 23 9 9 9 21 16 24 24 24 24 26 33 33 33 31 31 27 15 17 7 4 4 4 16 20 27 33 34 34 23 15 14 8 9 6 6 9 1 14 16 8 11 15 23 25 34 36 31 33 16 16 6 6 6 9 8 14 9 11 11 9 13 13 10 8 10 9 9 7 8 20 20 20 14 14 10 10 10 16 8 8 6 6 8 9 10 7 8 8 8 8 6 8 6 6 8 12 9 8 7 13 10 8 8 9 8 8 8 9 6 6 6 6 8 6 6 6 6 6 10 11 10 12 12 10 7 6 6 7 6 6 7 8 7 6 6 7 6 8 6 6 8 8 8 8 6 6 6 8 6 6 8 6 6 11 15 9 9 9 9 9 9 9 9 9 9 8 9 9 6 6 6 7 9 6 6 6 7 7 7 8 9 7 7 9 9 11 8 11 11 11 9 10 9 8 8 8 10 6 6 9 8 6 6 6 6 8 8 9 11 9 8 8 8 8 8 8 8 9 9 9 10 10 8 6 6 8 6 6 10 11 10 6 6 8 6 6 6 6 8 11 8 9 8 8 8 8 8 9 6 6 9 8 8 8 6 6 13 15 12 12 8 8 6 6 8 9 8 8 9 8 8 6 6 6 8 8 6 6 6 8 8 8 6 6 8 6 6 8 6 6 9 8 8 6 6 8 8 6 6 8 6 7 8 9 10 11 11 10 9 9 8 10 9 10 10 8 9 13 8 8 8 13 13 11 7 7 7 11 8 8 10 11 10 9 9 14 7 7 10 10 10 8 8 8 8 6 7 8 8 6 6 6 6 6 6 6 6 6 8 9 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 10 10 4 4 4 6 7 6 6 6 6 10 8 8 9 15 11 6 6 8 8 8 8 8 8 9 9 8 9 7 7 8 6 6 8 13 10 8 8 7 6 8 6 6 8 6 7 8 8 8 8 8 8 8 4 Sequence : 22ak93c2.r1t Is_read Padded Staden_id 11 Clipping QUAL 39 331 Align_to_SCF 1 43 1 43 Align_to_SCF 44 317 45 318 Align_to_SCF 319 716 319 716 SCF_File 22ak93c2.r1tSCF Primer Universal_primer Strand Reverse Dye Dye_terminator Template 22ak93c2 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 38 "M13mp18" Tag ALUS 43 180 Tag DONE 43 43 "AUTO-EDIT: deleted C at 43 (terminator, isolated, strong)" Tag DONE 254 254 "AUTO-EDIT: replaced T by g at 254 (terminator, isolated, strong)" Tag ALUS 269 402 Tag DONE 283 283 "AUTO-EDIT: replaced T by g at 283 (terminated, isolated, strong)" Tag AMBG 298 302 "AUTOEDIT: Check this edit cluster!" Tag DONE 317 317 "AUTO-EDIT: replaced C by a at 317 (terminated, compound, strong)" Tag DONE 318 318 "AUTO-EDIT: inserted g at 318 (terminated, compound, strong)" DNA : 22ak93c1.r1ta GGGGGGATGATACAATTCGAGCTCGGTACCTTCAAGCGATTCTCCTGCCTCAGCCTCCCG AGTAGCTGGGATTATAAACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTGTATTTTTA GTAGGGATGGGGTTTCACCATGTTGGCCAaGCTGGTCTCGAGCTCCTGACCTAGGATtAC AGGCCTAaGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAgGAGGAAGGGA TCCTAGAAAAACAGAGACAAgGCCAAACATGGTAGCTCACACCTGTAATCCCAGCACTTT GGGAgGCCAgTGCGGGTGAATCACgAAGTCAGGAGTTCAAGACCATCCTGGCCAACATGG TGTAACACCGTCTCTCCTAGGATAAACCGAAATCACCTGGGTGTCCTGGCAAGTGCCTGT CATCCCTGACCACTTGGAAAGCTGAGCCGAATCCTTATCCCnGAAAGTAAGGTTACGTGA ACCCACATCAAACCACTGCGCTCCAGCCCAAAACATCGTGTTATACTCTGTCGCGACATT GATGCCCAAAAAACAGGACCGCTATTGGGAGACACTCCCGGGTAATTGGGATTGAGGAGG TTAAAGAAAACTCTTGATCTGAGAAAAAAGACCCTATCCTGGCGAGAAAACCACATGTGG ACCACACCGCTTCACTTTGTCTAAGCAAAAAACGCCCCACTTGAAGATGACCCCCCCAGC TGAAATCTTCCATTAATCCCCGAACATAAAGGTTTAACCCAAAATTTCCTGTTAGACCGC CTTCTGAAGTTTCTAAAATTCTATGGGTAGGGACAAAAGTCCCTCGTTGAATTTCTAGGA TACTTCCAAATATCCCCCACCTCTCCCCTGGGATCCCGATAGCTTTCTTGTCCCTAAAAA AAACTTTGTTCAAACGGAGAAACCACACCCGGGGAAAATTCCCCTTTTCTTGGGGTTTAG GTTTCTTTAAATAAATGCTGGGCACCAATCCTCAAATGAGTTCTTACCCAATCCCATATG TTTTTAATCCTCAACAACAACCTTATTTCCTTAAGAGACCTCTCCTCGGAAATCATTTCA AAACAAAAAAAACACTTAAGCCTTGGGTCTTTGGGACCCCCCAAAAAAAAAACATAAAGG GGTGGCACCGTATACGCCTTGCCCATCTTTCTAGTGGAAGATAACGAAACGGTAGCTGGG GCCAACCAGGCATCAGTGGGGGATACCGCTAAATGTTGGGGAACACCCAAAAACCCATCT GCAGGCACCGCGAATGCGGAAAAGCGCACGCTATCACAAATGGTATATGGGCACC BaseQuality : 22ak93c1.r1ta 8 10 8 9 16 9 9 9 11 8 8 9 10 11 11 10 19 24 26 24 26 22 21 17 13 16 11 11 10 10 14 14 19 22 24 26 32 32 33 29 29 29 27 27 27 27 27 32 32 25 27 20 25 19 32 27 29 32 32 32 34 34 21 23 12 14 14 27 32 32 29 28 27 34 31 34 34 34 37 34 32 32 30 30 28 28 28 30 30 33 33 33 30 30 34 34 34 37 40 38 37 34 32 34 32 37 32 37 37 28 28 28 33 33 33 33 32 30 30 29 28 21 23 14 12 30 32 45 45 41 41 30 25 22 33 33 34 23 21 18 12 12 11 13 27 27 23 23 11 11 9 10 11 18 18 30 15 20 12 11 10 20 12 14 14 32 32 33 28 28 18 23 18 12 12 20 12 16 13 18 14 15 12 32 23 21 10 10 9 9 10 16 18 21 9 9 9 18 21 14 14 12 10 14 14 23 27 24 19 19 24 28 30 29 29 34 34 29 25 17 12 12 16 14 14 23 10 10 10 11 15 21 24 18 25 11 11 15 32 28 34 34 29 32 32 37 37 34 34 31 28 28 25 22 17 14 11 10 10 8 8 9 14 8 8 12 17 18 15 13 18 17 17 10 10 10 22 16 24 30 24 28 27 32 19 12 12 12 30 21 17 9 9 9 9 17 16 24 24 23 20 12 12 7 7 7 14 13 10 10 10 23 23 22 15 17 18 24 24 15 17 11 10 8 8 8 13 20 25 17 17 17 20 20 18 10 11 12 12 11 25 10 12 12 9 8 8 8 8 8 12 14 9 9 9 9 10 10 8 8 11 9 9 9 14 20 20 19 15 15 15 15 11 11 6 6 9 8 10 12 12 15 15 10 9 10 11 7 7 9 11 14 11 11 10 11 9 14 14 23 19 18 14 12 10 10 10 10 10 16 11 11 9 8 8 9 8 11 11 9 8 8 10 9 12 13 9 9 8 8 8 8 8 6 6 11 6 6 8 11 9 9 9 6 6 12 9 9 6 6 8 11 9 8 6 7 9 9 7 8 4 4 4 6 8 6 6 8 8 6 6 8 6 8 12 12 14 10 9 10 11 9 8 7 7 7 7 10 8 8 6 6 8 6 6 8 10 8 6 6 10 8 10 9 10 10 9 8 8 6 6 6 6 8 8 8 9 9 9 9 7 7 9 9 10 10 10 13 12 9 9 9 9 7 8 8 8 9 8 8 9 9 9 8 6 6 8 6 6 6 7 7 9 9 10 8 8 7 7 7 9 10 10 8 6 6 6 6 6 10 10 8 6 6 8 8 8 7 9 7 10 7 11 8 8 8 8 9 9 9 8 8 6 6 10 11 16 8 7 7 7 6 8 6 6 8 10 11 9 9 9 7 7 8 7 7 7 7 7 8 11 9 16 16 24 22 15 9 8 13 13 12 12 9 9 9 9 9 7 7 7 7 7 7 7 8 7 7 7 6 9 11 9 8 8 9 9 9 7 9 10 14 12 9 9 8 8 6 6 6 6 8 6 6 8 6 6 6 6 6 9 8 10 10 9 10 10 13 10 11 6 7 11 6 6 8 6 6 6 6 6 6 9 9 7 7 8 8 8 8 8 9 8 9 13 11 8 6 6 6 9 9 8 8 8 8 8 8 8 11 8 7 10 12 7 7 9 8 6 6 8 8 7 7 10 8 8 7 7 7 8 8 8 8 7 7 7 7 7 10 9 10 12 10 7 7 6 9 6 6 6 6 7 9 7 7 4 10 9 7 6 8 6 6 8 6 6 9 6 7 7 10 10 10 10 13 13 8 9 8 8 8 6 7 10 11 10 9 8 6 6 6 6 6 8 8 7 9 7 7 7 7 7 7 7 10 10 10 8 8 8 7 7 8 8 8 8 6 6 7 7 7 9 8 6 8 6 6 6 8 8 8 7 9 9 12 15 9 8 7 9 8 8 9 8 8 6 8 12 11 7 7 7 7 7 7 9 11 11 9 9 9 10 9 9 9 8 8 8 8 8 7 7 12 13 13 15 11 11 7 7 7 9 11 10 12 6 6 6 6 8 7 7 7 8 10 10 10 10 13 9 12 11 11 6 6 6 6 8 8 6 7 7 12 10 13 9 8 7 7 10 7 7 15 17 15 12 17 20 15 13 15 6 6 6 6 8 8 6 6 6 7 7 7 10 7 7 10 11 8 8 5 5 8 8 12 12 8 10 6 6 6 6 8 8 7 7 7 12 10 7 7 9 7 7 9 9 8 9 10 10 8 8 9 11 9 8 9 9 11 11 9 9 8 6 8 6 6 6 6 6 6 6 6 8 8 8 8 12 6 6 6 6 8 6 7 7 6 8 6 6 8 8 10 11 10 12 7 8 8 9 12 6 6 6 6 6 6 6 6 8 9 9 9 9 9 8 7 8 7 7 7 8 7 7 7 7 9 9 9 9 6 6 6 6 14 8 8 8 8 8 6 6 7 7 7 11 9 7 6 6 6 6 10 6 6 6 8 8 7 8 7 7 6 7 7 8 8 12 13 15 15 21 9 10 9 8 8 10 6 6 6 6 4 4 4 8 8 8 7 6 6 6 6 6 6 6 6 6 6 6 9 9 9 6 6 6 10 6 10 15 20 12 9 8 6 6 6 6 6 8 8 6 6 6 6 8 12 13 12 10 9 8 11 8 10 9 7 7 4 4 6 6 8 4 4 4 6 8 6 6 6 8 8 13 10 8 9 9 9 7 7 9 10 8 8 6 6 6 6 6 6 10 11 10 10 10 7 7 8 6 6 8 6 6 8 10 13 8 11 8 11 10 6 6 6 7 11 14 11 11 6 6 8 8 8 9 9 9 9 7 7 10 10 6 6 6 6 6 6 8 8 8 7 7 7 8 8 11 11 11 7 6 8 6 6 8 8 6 6 10 10 13 8 8 6 6 6 8 9 9 6 6 9 9 8 8 6 6 8 6 6 8 8 4 Sequence : 22ak93c1.r1ta Is_read Padded Staden_id 12 Clipping QUAL 31 335 Align_to_SCF 1 1315 1 1315 SCF_File 22ak93c1.r1taSCF Primer Universal_primer Strand Reverse Dye Dye_terminator Template 22ak93c1 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 30 "M13mp18" Tag ALUS 31 172 Tag DONE 150 150 "AUTO-EDIT: replaced T by a at 150 (terminator, isolated, strong)" Tag DONE 178 178 "AUTO-EDIT: replaced G by t at 178 (terminator, isolated, strong)" Tag DONE 188 188 "AUTO-EDIT: replaced T by a at 188 (terminator, isolated, strong)" Tag DONE 230 230 "AUTO-EDIT: replaced T by g at 230 (terminator, isolated, strong)" Tag DONE 261 261 "AUTO-EDIT: replaced C by g at 261 (terminated, isolated, strong)" Tag ALUS 262 446 Tag DONE 305 305 "AUTO-EDIT: replaced T by g at 305 (terminated, isolated, strong)" Tag DONE 310 310 "AUTO-EDIT: inserted g at 310 (terminated, compound, strong)" Tag DONE 325 325 "AUTO-EDIT: replaced A by g at 325 (terminated, isolated, strong)" DNA : 22am91h5.r1t GGGnnATAGATACGATCCGAGCTCGGTACCCATGTTGGCCAAGCTGGTCTCGAGCTCCTG ACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGC AGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACATGGTAGCTCACACCTGTAA TCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCAGCC TGGCCAACATGGTGAAACACCGTCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCGTG GCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAGAATCGCTTGAACCCGG GAGGTGGAGGTTGCAnTGAGCCGAGATCACGCGACTGCACTCCAGCCCAACCAATAATGT GAGACTCTGTCTCGAnAAnnnAAAGCnGAAAACAGACnnCTAGTACnGTACTTAACGGGG TAATTATAATAATTAAATGAAAAAAATAnCTGTGAGGTGATTGATATAnTGCTGTTGCTA AATACAACTAACATTTTAATATACCGGTGGAGTGTTTCTAATCTGAnAATCCAAATTAGA AATGCTCACAGTCTGAAACTTTTTGAGCACCAACTAATGTTCAAAGAATTGCTATGGACC ATATGGGTGGTTGATTTT BaseQuality : 22am91h5.r1t 4 8 4 4 4 4 4 7 10 9 10 15 10 7 7 10 10 9 19 20 33 34 34 34 36 36 33 33 31 33 33 32 31 31 26 26 27 23 30 26 26 26 26 34 34 38 38 38 37 45 45 37 37 37 37 45 45 45 45 37 37 37 45 45 32 18 10 21 18 28 29 33 33 33 33 45 45 42 42 37 33 33 33 36 33 33 30 30 30 30 32 36 33 33 33 33 33 33 37 37 45 45 37 37 37 33 33 35 35 35 35 43 35 42 42 35 35 34 34 34 29 29 22 27 27 27 37 27 37 45 33 30 30 37 28 32 32 10 10 21 32 32 34 27 23 12 11 9 9 9 18 21 28 31 33 30 30 30 30 34 34 34 34 31 33 34 34 33 31 33 33 33 33 33 33 45 45 40 37 37 37 33 33 30 30 30 30 33 30 33 26 26 26 25 23 18 14 12 20 23 27 25 21 21 21 28 28 30 31 31 31 31 32 21 21 12 6 6 9 9 14 17 19 17 10 16 13 8 8 11 13 9 13 12 14 14 21 23 26 34 36 34 31 22 24 20 28 28 33 27 28 25 27 24 34 32 23 12 12 12 23 23 33 28 34 34 37 32 32 15 11 11 32 32 40 37 38 18 11 9 9 18 25 45 34 28 28 9 9 20 29 45 38 34 23 23 10 23 23 33 33 33 21 21 13 25 25 25 29 27 33 30 33 33 34 33 30 30 19 19 30 30 30 26 26 30 27 27 23 19 15 24 27 28 21 9 9 9 19 14 12 10 12 12 13 17 28 18 19 21 24 24 25 24 24 24 24 18 18 13 18 8 8 8 10 10 10 7 7 7 8 8 12 15 4 4 4 25 18 21 17 15 16 14 9 9 17 14 17 9 17 8 8 10 10 10 11 17 17 22 24 23 24 24 19 13 10 8 15 15 10 9 9 9 16 12 12 14 19 18 26 24 22 22 24 25 21 24 24 32 19 20 9 9 4 4 4 4 4 4 4 4 17 16 16 4 4 4 7 10 8 7 6 13 8 8 4 4 4 4 8 8 7 7 7 4 4 4 17 23 12 9 8 7 7 8 7 10 10 8 6 6 6 6 6 10 10 7 7 7 7 9 7 8 10 7 7 8 6 6 8 8 8 9 10 7 12 4 4 4 9 9 7 6 6 7 6 6 10 9 7 8 10 7 7 7 9 4 4 4 14 8 8 9 7 6 6 8 8 8 7 7 6 6 9 7 7 10 13 8 9 8 8 8 14 7 7 7 7 9 8 12 12 4 4 4 7 7 7 7 8 8 8 7 7 7 7 7 7 8 10 8 6 6 6 4 4 4 8 12 9 9 17 9 7 7 7 7 6 6 6 6 8 10 6 6 6 8 6 6 6 6 6 6 6 6 6 6 6 6 6 13 11 9 8 7 8 7 7 7 8 7 9 8 7 6 6 4 6 6 8 7 7 7 6 8 6 6 8 7 7 9 9 10 11 7 6 6 6 6 6 12 9 8 8 12 11 10 8 7 7 4 4 4 7 7 8 4 Sequence : 22am91h5.r1t Is_read Padded Staden_id 20 Clipping QUAL 32 361 Align_to_SCF 1 678 1 678 SCF_File 22am91h5.r1tSCF Primer Universal_primer Strand Reverse Dye Dye_terminator Template 22am91h5 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 31 "M13mp18" Tag ALUS 153 443 DNA : 22aq40a8.s1 AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACAGAGACAAGGCCAAACATGG TAGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAGGTCAG GAGTTCAAGACCAGCCTGGCCAACATGGTGAA-CACCGTCTCTACTAAAATAAAAAGAAA TTAGCTGGGTGTCGTGGCAGGTGCTtGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAG AATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTCCA GCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACTAG TACAGTACTTACAGGGTTATTATGATGATTAnATGAGAGAATAGCTGTGAGGTGATTGAT ATAGTGCTGTGCTTAAATACAACTATCAATTTTATTATACGGGGTTGAGTGTTTCCAATC TGAAAATCCCAAATTTGGAATGCTCTACGGTCTGAAACCTTTTTTGAGCACCGACCTAAA BaseQuality : 22aq40a8.s1 7 9 10 11 11 23 27 25 25 9 9 9 12 14 23 27 24 21 21 16 22 22 22 24 23 23 23 30 30 30 30 30 32 34 31 31 34 34 28 28 28 30 30 30 28 28 28 34 34 34 34 34 34 37 34 34 34 34 34 34 37 37 37 37 37 37 37 32 34 29 29 29 45 38 40 40 37 37 32 37 37 37 37 37 37 37 37 37 40 40 40 40 40 37 30 30 32 22 22 22 32 32 41 45 45 41 41 45 30 32 27 32 32 40 37 37 40 37 37 45 45 45 40 40 37 37 37 37 37 37 37 37 40 37 37 37 31 32 28 28 28 32 32 37 34 37 38 38 38 27 27 11 1 11 10 21 27 34 34 37 37 34 34 45 45 45 38 37 37 37 37 37 37 34 34 34 34 33 30 30 28 28 28 28 28 30 37 37 37 37 33 36 36 31 31 31 24 24 24 24 21 21 17 12 4 4 4 14 17 26 25 25 31 34 34 31 31 31 33 31 31 34 35 37 37 32 32 34 34 30 31 31 34 30 33 30 30 30 33 33 30 30 23 22 22 32 32 40 34 36 34 31 26 28 26 24 16 9 9 9 8 15 22 22 25 25 31 31 30 30 28 30 30 30 30 28 28 28 30 30 30 30 30 37 32 27 23 18 18 27 27 34 34 31 33 30 30 28 28 28 28 28 30 34 33 33 33 33 30 26 26 23 23 23 30 37 36 32 32 24 23 21 20 28 31 29 30 22 21 18 13 15 23 26 34 34 36 33 30 30 30 30 25 25 25 26 23 26 25 24 24 25 27 25 22 14 15 12 12 12 21 21 25 25 22 21 21 24 19 19 14 16 11 13 14 20 27 30 28 28 28 30 33 34 34 23 23 16 7 7 4 4 4 18 17 21 23 21 17 11 13 18 18 18 20 18 18 11 14 7 7 7 15 20 18 11 10 15 23 18 16 10 8 8 13 17 18 14 14 14 13 13 14 17 18 13 13 9 9 9 14 12 18 18 11 11 5 5 5 6 6 6 8 12 10 13 15 11 11 11 8 6 6 6 6 6 8 6 6 8 8 8 7 7 9 9 8 8 19 8 8 14 8 8 6 6 11 9 9 8 14 6 6 7 7 8 6 7 6 6 9 9 10 15 14 12 7 7 7 7 13 15 22 22 19 14 9 8 8 8 12 15 19 7 6 10 9 8 6 7 9 9 10 10 8 8 7 7 4 4 Sequence : 22aq40a8.s1 Is_read Padded Staden_id 3 Clipping QUAL 39 388 Align_to_SCF 1 152 1 152 Align_to_SCF 154 540 153 539 SCF_File 22aq40a8.s1SCF Primer Universal_primer Strand Forward Dye Dye_primer Template 22aq40a8 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 38 "M13mp18" Tag ALUS 49 339 Tag DONE 206 206 "AUTO-EDIT: replaced N by t at 206 (terminated, compound, strong)" DNA : 22an02b10.s1t CGTGCCTGCAGGTCGACTCTAGAGGATCCCCCCTGTAATCCCAGCACTTTGGGAGGCCAg TGCGGGTGAATCACgATGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCG TCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCgTGGCAGGTGCCTGTAATCCCAGCC ACTTGGGAAGCTGAgGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCC GAgATCACGCGACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAA AAAGCAGAGACAAGACAACTAGTACAGTACTTACaGGGTTATTATGATGATTAAATGAGA gAATAGCTGTGAgGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATA CGGGTTGAGTGTATCTAATCTGAAAATCCAAAATCAGAAATGCGCTACAGTCTGAAACTT TTTTGAGCACCGACCTAATGTTCCAAGGAAGTGCTTATCGGAGCACCATGGGTCGGTACA CATTTGGGTCGGGAATATnCCACCAGTGAGTACCATAAAATGCCAATATCCCCTCCCACC CCCAACA BaseQuality : 22an02b10.s1t 7 7 9 12 10 15 16 17 13 13 21 18 23 17 28 28 37 37 37 33 26 26 17 19 12 21 25 36 45 45 34 34 34 34 34 37 37 37 37 37 32 25 9 9 13 17 17 14 18 18 21 29 32 19 18 18 18 21 9 9 9 23 19 30 30 37 29 37 37 32 34 23 20 13 13 10 13 22 32 21 17 17 23 18 10 10 10 12 13 9 9 14 23 29 28 22 22 32 33 37 34 34 34 34 34 34 34 30 37 32 37 37 41 34 33 33 33 21 21 14 14 14 24 28 41 37 32 32 21 21 21 25 30 30 37 30 37 30 30 30 32 36 28 27 17 27 27 37 32 37 36 37 25 23 10 10 10 32 21 23 10 15 10 23 23 36 32 32 34 34 34 37 37 25 25 13 9 9 21 25 25 32 32 32 41 32 28 28 11 22 22 32 32 13 13 10 11 9 10 10 12 12 14 32 32 29 22 22 21 21 17 21 27 41 41 41 28 27 32 27 27 29 37 32 34 17 15 14 28 23 25 20 9 9 9 25 10 12 12 14 13 10 10 9 16 13 23 23 14 14 22 25 34 28 28 22 28 28 28 19 18 10 10 11 19 21 28 28 28 30 30 30 23 18 10 10 28 32 32 34 28 28 28 28 28 31 34 34 25 25 12 19 11 14 14 25 21 24 24 18 18 18 22 23 13 11 10 10 10 10 14 13 10 9 9 7 8 14 17 16 10 10 13 16 15 18 18 18 18 14 15 12 12 9 12 9 12 12 13 9 14 10 18 19 14 9 13 11 18 14 15 15 16 20 19 18 14 9 8 8 6 6 6 11 9 9 14 17 20 12 13 6 6 8 8 11 10 21 23 15 14 13 13 14 21 27 28 32 29 34 28 27 23 14 10 10 12 17 15 13 11 11 11 18 28 33 24 18 14 12 17 12 12 18 22 19 19 24 28 20 21 19 19 20 17 17 26 25 20 9 14 7 7 7 15 21 33 27 27 18 20 19 15 15 20 18 14 14 8 8 9 9 9 7 7 7 7 7 8 9 9 12 7 7 9 11 10 11 13 13 11 7 7 8 15 17 26 25 25 27 25 24 21 19 20 18 13 13 14 9 9 14 18 17 12 15 16 21 20 18 8 7 6 6 6 13 20 25 18 11 14 9 9 9 11 11 12 12 15 15 18 10 10 8 8 10 10 9 9 9 16 11 7 7 6 6 8 4 4 4 4 4 6 10 10 13 13 12 6 6 6 6 12 15 12 11 11 4 4 4 6 6 6 6 6 8 6 6 6 8 6 8 11 13 8 8 6 6 6 6 9 16 9 13 13 17 14 13 9 7 7 12 8 8 8 9 9 9 9 9 9 8 8 8 10 9 7 Sequence : 22an02b10.s1t Is_read Padded Staden_id 21 Clipping QUAL 32 446 Align_to_SCF 1 607 1 607 SCF_File 22an02b10.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22an02b10 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 31 "M13mp18" Tag ALUS 32 301 Tag DONE 60 60 "AUTO-EDIT: inserted g at 60 (terminated, compound, strong)" Tag DONE 75 75 "AUTO-EDIT: replaced A by g at 75 (terminated, isolated, strong)" Tag DONE 156 156 "AUTO-EDIT: replaced C by g at 156 (terminated, isolated, strong)" Tag DONE 195 195 "AUTO-EDIT: replaced A by g at 195 (terminated, isolated, strong)" Tag DONE 243 243 "AUTO-EDIT: replaced T by g at 243 (terminated, isolated, strong)" Tag DONE 335 335 "AUTO-EDIT: replaced T by a at 335 (all_stranded, isolated, strong)" Tag DONE 361 361 "AUTO-EDIT: replaced C by g at 361 (terminated, isolated, strong)" Tag DONE 373 373 "AUTO-EDIT: replaced C by g at 373 (terminated, isolated, strong)" DNA : 22ak67d6.r1t CGCGCCCCTCnGACTCCGGCCCTAnCACGGTACCCACTTTGGGAGGCCAGTGCGGGTGAA TCACGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCGTCTCTACTAA AATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAG CTGAgGCAGGAGAATCGCTTGAACCCGGGAgGTGGAGGTTGCAGTGAGCCGAGATCACGC GACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGA TCAGATCACTAGTACAGTACTTACGGGCTTATTATGATGATTAAATGAGAGAATACCTGT GAGGTGATTGATATATTGCTGTGCTTAATACAnACTATCATTTTATTATACGGGTCGAGT GTTTCTAATCTGACAATCCAAATTAGAAATGCTCTACAGTCTGAAACCTTTTTGAGCACC CACCTACTGTTCAAAGGACGTGCTTATTGGAGCATTATGGGTTGTAACATTTTTGGGTTG GGAATTTTCACCCATTAGTACTATAAATGCCATTTTCCAAAAAATCTGAATCTAAAATTT CTGGTCCTACCAGCATTTGCTAGGGATCCCACCCGTCTTCTTCCTTACCTGTTTAAGTCT TATAAATC BaseQuality : 22ak67d6.r1t 6 6 6 4 8 11 15 8 4 4 4 4 8 6 6 9 7 8 9 8 4 4 4 4 4 4 10 9 9 21 19 33 30 33 30 30 30 28 28 28 23 23 20 11 11 16 12 13 17 21 25 28 33 33 33 38 34 34 34 33 30 22 22 12 14 21 10 12 21 21 16 14 11 13 13 14 21 21 21 19 15 18 23 23 25 30 28 33 38 38 33 33 30 30 30 30 30 30 30 37 37 45 45 33 33 33 33 33 33 40 42 49 42 40 40 40 34 34 31 35 34 35 37 42 42 37 32 19 9 9 11 23 19 28 30 30 28 38 45 37 37 37 32 32 24 34 34 30 30 26 21 20 11 27 27 40 34 30 30 28 30 30 30 23 18 17 9 9 18 16 16 24 24 24 23 21 18 11 11 18 25 25 16 9 7 9 15 11 8 7 9 7 7 8 16 16 27 28 25 20 16 10 10 9 13 8 8 7 12 4 4 4 14 6 6 6 7 9 6 7 7 7 7 16 10 20 15 13 11 9 9 8 8 8 15 8 10 10 17 14 9 9 19 15 15 7 7 12 20 19 25 25 22 18 17 7 9 12 20 21 25 21 21 20 22 28 32 30 25 25 12 12 18 32 32 36 49 49 33 33 24 20 13 12 16 18 20 14 25 23 25 19 12 11 8 8 4 4 4 4 4 8 8 6 4 6 8 15 17 21 19 15 8 8 8 8 10 7 7 13 9 7 11 14 6 6 4 4 4 6 12 8 13 17 21 18 19 19 20 18 18 15 10 15 14 13 14 8 8 8 9 8 8 10 10 8 8 15 17 17 17 17 14 13 19 17 16 12 10 14 15 17 15 14 8 8 7 7 15 19 18 12 11 16 12 15 11 10 13 13 11 4 4 4 10 12 12 18 12 14 9 10 9 10 21 22 18 14 6 6 6 6 6 8 4 4 4 8 8 7 8 7 9 14 7 8 7 10 16 31 17 14 4 4 4 10 11 8 10 13 17 13 8 8 9 8 8 12 12 14 14 7 7 7 7 7 7 7 8 9 13 11 10 7 10 7 6 6 10 8 8 23 23 12 7 7 7 7 7 10 10 18 6 6 6 6 6 6 7 7 7 6 6 6 7 6 6 4 4 4 4 8 11 18 15 23 11 9 8 7 7 7 7 7 7 8 15 18 8 10 10 12 8 6 8 6 6 6 7 7 12 10 12 18 11 12 10 19 19 15 15 10 10 9 7 11 7 8 9 10 7 7 6 6 6 6 4 6 7 7 7 7 9 9 9 13 13 9 7 7 7 9 7 7 7 6 6 6 6 8 8 9 8 11 8 7 6 6 6 6 9 7 8 7 7 6 8 6 6 9 10 12 10 13 12 6 6 6 6 6 7 6 6 7 7 7 11 13 11 9 8 6 6 8 6 6 8 12 14 8 8 8 6 13 8 8 8 6 7 8 7 8 9 8 10 6 6 10 11 17 20 16 11 11 7 6 8 8 9 8 6 12 10 7 7 8 8 4 Sequence : 22ak67d6.r1t Is_read Padded Staden_id 19 Clipping QUAL 30 292 Align_to_SCF 1 668 1 668 SCF_File 22ak67d6.r1tSCF Primer Universal_primer Strand Reverse Dye Dye_terminator Template 22ak67d6 Clone bK216E10 Sequencing_vector "m13mp18" Tag ALUS 35 291 Tag DONE 185 185 "AUTO-EDIT: replaced C by g at 185 (terminated, isolated, strong)" Tag DONE 211 211 "AUTO-EDIT: replaced T by g at 211 (terminated, isolated, strong)" DNA : 22ak64b1.s1t TGGGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTGAAACACCGTCTCTACTAAA ATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGC TGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAgATCACGCG ACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGAC AAGAcCACTAGTACAGTACTTACAGGGTtATTATGATGATTAAATGAGAGAATAGCTGTG AGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTG TTTCTAATCTGAaAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACC GACCTAAATGTTCAAAGGGAGGTGCTTAATTGGAGCATTATGGGTTGTTAGATCTTTGGG TTGGGAATATTCAACC BaseQuality : 22ak64b1.s1t 4 4 8 11 13 20 16 16 16 19 24 32 31 37 37 35 34 29 32 18 32 24 33 33 37 37 37 23 32 11 10 21 17 37 34 34 45 45 45 45 32 29 26 26 28 30 30 33 45 45 49 49 45 43 45 45 45 45 45 37 45 45 45 45 45 45 45 37 37 37 38 32 40 37 41 37 45 32 45 45 44 37 45 30 45 45 33 33 33 33 33 22 37 37 45 45 45 40 37 34 37 37 33 32 32 33 33 33 33 40 40 40 42 40 42 37 37 37 45 45 45 45 45 35 34 34 28 28 18 21 17 17 27 38 38 45 34 34 34 34 34 34 34 34 34 34 34 34 34 34 34 37 34 34 33 33 33 33 28 31 31 36 34 31 36 36 34 33 20 14 8 8 8 8 14 23 27 31 36 33 36 38 30 30 28 28 28 30 30 27 30 30 30 30 33 33 23 21 18 18 17 20 32 37 37 45 45 45 45 34 34 34 45 45 45 44 45 37 45 45 45 37 40 37 37 33 40 44 40 40 36 31 31 28 25 22 27 14 14 8 9 10 8 7 8 7 12 18 18 23 15 9 9 15 15 20 20 25 28 25 21 21 18 18 8 9 8 6 6 8 11 14 28 28 28 30 30 30 30 31 30 31 25 22 22 27 15 15 15 16 13 17 25 25 30 25 27 28 31 24 24 19 24 29 33 27 31 31 31 31 28 27 22 14 15 27 32 40 37 36 36 36 33 33 34 33 27 13 14 7 7 8 18 23 32 32 23 20 20 33 30 27 27 21 14 14 18 21 18 21 15 15 17 11 11 16 24 23 30 23 14 10 13 14 15 10 8 9 16 16 28 4 4 4 10 11 12 9 8 10 14 20 18 19 19 19 10 10 12 15 25 23 26 26 28 18 14 14 16 20 15 14 12 12 12 21 23 25 24 21 17 17 14 21 20 19 12 9 9 8 9 8 10 7 6 9 8 7 8 9 7 7 7 6 6 8 7 8 6 6 6 6 6 13 11 6 6 6 8 10 11 8 9 9 10 10 15 10 11 12 16 13 10 9 7 7 7 7 9 10 8 8 7 6 6 6 6 6 14 10 7 7 7 9 9 10 11 16 16 7 6 4 4 4 8 4 Sequence : 22ak64b1.s1t Is_read Padded Staden_id 8 Clipping QUAL 40 416 Align_to_SCF 1 496 1 496 SCF_File 22ak64b1.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak64b1 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 39 "M13mp" Tag CONF 44 44 "AUTOEDIT: possible compression" Tag CONF 96 96 "AUTOEDIT: possible compression" Tag DONE 172 172 "AUTO-EDIT: replaced A by g at 172 (terminated, isolated, strong)" Tag DONE 245 245 "AUTO-EDIT: replaced A by c at 245 (all_stranded, compound, strong)" Tag AMBG 246 246 "AUTOEDIT: Check this edit stack (conflict & possible misassembly))!" Tag DONE 269 269 "AUTO-EDIT: replaced C by t at 269 (all_stranded, isolated, strong)" Tag DONE 373 373 "AUTO-EDIT: replaced N by a at 373 (terminated, isolated, strong)" DNA : 22ak81h10.s1t GTGGCATGCCTGCAGGTCAACTCTAAAAGATCCCCTGAAACACCGTCTCTACTAAAATAA AAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAgCCACTTGGGAAGCTGAG GCAGGAGAATCGCTTGAACCCGGGAgGTGGAgGTTGCAGTGAGCCGAGATCACGCGACTG CACTCCAGCCCAAcCAATAGTGTGAGACTCTGTCTCGAaaAAaAAAAAGCAgAGACaAGA CCACTAGTACAGTACTTACAGGGTTATTATGATGATTAAaTGAGAGAATAGCTGTGAGGT GATTGATATAGTGCTGTGCTTAATACaAACTATCATTTTATTATACGGGTTGAGTGTTTC TAATCTGAAAATCCaaAATTAGAAATGCTCTACAGTCTGAAACTTTtTTGAGCACCGACC TACTGTGCACAGGAAGTGCTTATTGGAGCATGATGGGTTGTTACATATTTGGGTTGGGAA TATTCACCCAGTAAGTACTATAAAATGCAAATATTCCAACAAG BaseQuality : 22ak81h10.s1t 6 6 6 6 6 8 9 16 11 13 21 20 22 22 22 15 14 9 9 9 9 15 18 15 9 9 9 9 9 15 23 36 36 36 36 34 38 40 30 28 28 28 30 32 37 37 36 38 37 44 45 45 49 49 45 45 37 37 38 45 45 45 38 37 37 38 38 37 37 34 34 34 32 32 38 45 49 45 45 45 45 37 33 33 27 27 18 18 30 32 36 36 36 36 36 36 36 34 32 21 18 4 4 4 18 17 27 28 33 36 36 36 49 36 36 36 34 34 45 27 27 30 25 27 12 20 20 34 34 38 37 37 34 34 25 25 18 18 21 29 38 45 21 28 14 14 14 27 21 34 18 17 17 32 27 25 22 13 13 10 18 15 32 32 32 37 28 22 22 21 14 10 10 11 23 22 28 20 14 14 8 8 11 20 20 16 12 16 16 28 21 19 10 10 10 19 18 20 20 14 14 32 32 34 32 25 18 18 18 18 27 32 32 24 24 23 23 14 10 10 10 9 9 10 11 12 12 12 12 17 11 11 11 10 8 6 6 8 8 10 16 16 16 11 14 10 9 9 9 17 11 11 11 14 15 22 18 14 14 11 11 15 27 22 19 23 27 30 28 22 18 16 11 10 10 11 9 10 11 11 12 15 20 27 27 23 21 14 10 10 10 10 14 22 25 22 14 14 22 32 38 34 34 34 31 24 18 14 12 9 10 10 23 18 24 16 16 18 18 18 19 18 17 21 18 18 12 14 21 27 37 34 34 28 28 34 27 27 28 31 20 18 11 9 9 12 11 11 27 15 15 20 23 26 14 8 8 8 8 14 16 23 19 19 28 31 31 31 25 18 11 11 18 10 10 10 10 11 12 16 16 21 23 12 12 13 23 13 13 19 11 10 10 10 10 10 18 21 28 16 19 29 32 19 19 8 8 8 10 10 18 18 22 21 16 18 22 21 11 11 14 14 15 14 18 7 7 7 7 7 7 14 18 10 10 9 9 14 15 15 23 20 22 19 19 21 16 11 11 9 8 8 9 9 18 14 11 9 9 15 8 9 10 8 9 8 8 8 14 14 25 27 16 9 8 14 8 9 17 13 18 15 8 8 7 7 7 7 6 6 6 6 6 4 4 4 8 9 10 17 11 15 12 17 9 9 10 7 7 7 10 11 10 7 7 7 6 6 8 6 6 8 4 Sequence : 22ak81h10.s1t Is_read Padded Staden_id 5 Clipping QUAL 36 418 Align_to_SCF 1 523 1 523 SCF_File 22ak81h10.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak81h10 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 35 "M13mp1" Tag ALUS 36 216 Tag DONE 103 103 "AUTO-EDIT: replaced N by g at 103 (terminated, isolated, strong)" Tag DONE 146 146 "AUTO-EDIT: replaced T by g at 146 (terminated, isolated, strong)" Tag DONE 152 152 "AUTO-EDIT: replaced A by g at 152 (terminated, isolated, strong)" Tag DONE 194 194 "AUTO-EDIT: replaced G by c at 194 (all_stranded, isolated, strong)" Tag DONE 219 219 "AUTO-EDIT: replaced G by a at 219 (all_stranded, compound, strong)" Tag DONE 220 220 "AUTO-EDIT: replaced C by a at 220 (all_stranded, compound, strong)" Tag DONE 223 223 "AUTO-EDIT: replaced G by a at 223 (all_stranded, isolated, strong)" Tag DONE 232 232 "AUTO-EDIT: replaced C by g at 232 (all_stranded, isolated, strong)" Tag DONE 237 237 "AUTO-EDIT: replaced G by a at 237 (all_stranded, isolated, strong)" Tag DONE 280 280 "AUTO-EDIT: replaced G by a at 280 (terminated, isolated, strong)" Tag DONE 327 327 "AUTO-EDIT: replaced G by a at 327 (terminated, isolated, strong)" Tag DONE 375 375 "AUTO-EDIT: replaced T by a at 375 (terminated, compound, strong)" Tag DONE 376 376 "AUTO-EDIT: replaced C by a at 376 (terminated, compound, strong)" Tag DONE 407 407 "AUTO-EDIT: replaced C by t at 407 (terminated, isolated, strong)" DNA : 22ak66c6.s1t nCGTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCACCGTCTCTACTAAAATAAAAAGA AATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGG AGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTC CAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACT AGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTG ATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTTTCTAATC TGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATG TTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTC AACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATtTC TGGTCCTAAGCAAGCATnTTGCAAAGGGATACGCAACCTGTAGTACGTCCTTTATCATTG TnTCAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAnCAnATTCGATTGTA TTATT BaseQuality : 22ak66c6.s1t 4 4 8 4 6 10 13 21 24 25 33 33 33 30 27 21 15 27 19 30 30 33 33 30 21 21 10 9 17 11 27 27 37 38 33 35 35 35 35 44 45 45 38 37 37 45 45 45 43 43 43 45 45 45 45 45 45 45 21 21 23 30 30 34 37 37 38 45 32 45 37 41 37 45 30 45 45 34 34 34 32 29 22 32 32 45 45 45 33 28 28 37 37 34 34 34 35 34 34 34 34 34 34 37 37 40 41 37 34 37 37 37 32 24 22 27 29 25 27 20 21 21 21 27 45 41 40 40 40 42 34 34 37 41 45 51 45 45 37 30 37 41 41 37 36 28 30 30 30 22 33 33 35 33 33 41 51 51 45 39 39 39 30 28 33 34 34 39 34 41 34 34 41 33 33 39 39 39 33 33 33 30 33 33 33 30 29 19 19 24 25 32 33 45 36 36 36 36 41 41 30 30 30 37 37 43 51 51 51 51 45 37 37 30 37 37 37 51 51 51 51 51 37 37 28 28 10 10 10 13 10 10 10 9 9 9 21 21 28 37 37 37 33 33 33 33 33 33 34 34 34 33 33 33 33 21 25 25 22 22 29 29 33 33 33 33 31 31 27 28 17 23 23 28 26 24 32 10 10 10 15 15 26 32 32 37 45 45 32 45 33 26 24 32 37 37 35 34 37 35 37 34 37 37 40 37 37 45 45 38 38 45 45 40 37 37 37 34 30 30 28 28 28 30 37 37 34 34 34 34 34 33 31 31 25 21 19 22 21 25 30 32 32 30 22 22 25 28 24 25 26 17 17 23 27 27 33 31 31 34 38 38 38 38 34 26 17 15 8 8 11 16 25 31 32 33 29 26 32 29 33 34 34 34 36 33 34 34 31 27 31 34 38 45 45 36 37 37 37 36 36 38 34 32 28 25 22 22 21 17 18 29 29 23 23 22 27 25 20 18 11 11 15 15 16 23 21 17 19 24 24 24 31 31 31 33 33 33 31 33 33 29 29 29 29 29 31 31 31 23 24 19 12 10 16 10 10 20 10 10 13 15 30 23 29 23 28 18 10 10 16 21 18 19 19 24 24 12 11 9 9 10 21 23 31 31 33 28 28 14 17 17 28 21 30 24 30 28 22 26 23 19 10 10 12 23 22 23 19 12 10 9 9 10 19 24 29 30 34 34 34 34 34 29 25 25 32 26 31 31 32 20 17 15 12 12 4 4 4 17 23 33 30 24 18 13 18 16 12 16 8 9 9 19 15 15 4 4 4 7 11 6 6 6 7 8 9 17 12 13 19 23 25 13 13 13 19 21 29 32 30 26 20 20 12 9 9 8 9 8 8 15 24 17 15 8 8 9 17 16 4 4 4 8 8 13 15 23 14 9 8 8 10 10 17 23 21 17 12 13 22 20 19 15 11 11 9 8 8 8 8 8 8 10 9 9 7 8 8 10 12 10 10 12 4 4 4 4 4 4 10 10 10 10 10 9 8 8 7 8 9 11 9 9 4 Sequence : 22ak66c6.s1t Is_read Padded Staden_id 18 Clipping QUAL 37 548 Align_to_SCF 1 665 1 665 SCF_File 22ak66c6.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak66c6 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 36 "M13mp" Tag ALUS 38 221 Tag DONE 538 538 "AUTO-EDIT: replaced N by t at 538 (terminated, isolated, strong)" DNA : 22ak93c1.s1lt TTTCTTTGGGGGCAATCTTGATGCTAGCGTCGTTCAAGATGATCCACACCCAGCTCACTG TTTTATTCTCTCCAATAATCCTAAGCAAGCTCTCAAAATATAAATATGCTTTTTAATAAT ACAATCGAATTTGCTATACCACCTCAGAATCTGTACCACAATATATTAACTACTTAAAAC AATGATAAAGAACGTACTACAGGTTGCGTATCCCTTTGCAAAATGCTTGCTTAGGACCAG AAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTACTGGTTG AATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCCTTTGAAC ATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGATTTTCAG ATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCACTATATC AATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTACTGTACTA gTTGTCTTGTCTCTGCTTTTTTTTTTTCgAgACAGAGTCTCACACTATTGGTTGGGCTGG AATGCAnTCGCGTGATCTCGGCTCACTGGCAACCTCCACCTCCCGGGG BaseQuality : 22ak93c1.s1lt 4 4 4 4 4 4 4 4 9 6 4 8 15 11 4 6 4 12 8 9 10 12 11 8 8 6 7 8 14 14 9 4 4 8 8 8 8 8 4 6 8 11 9 10 8 9 9 11 10 9 9 9 9 9 9 16 16 32 23 29 21 27 27 22 22 20 28 32 37 37 34 31 30 28 28 24 29 29 34 34 38 32 32 18 22 18 22 22 28 29 37 37 37 37 35 35 34 34 35 34 37 37 37 37 37 37 34 37 37 37 37 32 32 28 28 31 30 30 30 23 23 23 28 27 21 32 13 13 16 24 32 34 31 30 28 28 28 28 28 34 34 34 34 33 25 16 9 9 10 23 32 33 41 37 34 28 30 30 30 28 28 22 27 25 32 25 30 27 22 24 22 22 28 25 24 30 30 30 30 30 30 24 28 13 10 10 23 20 18 9 9 9 18 23 30 30 30 28 24 19 25 11 11 12 27 31 34 30 30 30 30 37 45 51 41 39 28 28 28 25 25 24 30 34 39 39 39 39 39 39 36 31 13 10 9 10 10 23 23 9 9 13 23 31 31 14 14 31 31 13 9 9 9 23 23 23 13 9 9 9 31 31 41 51 36 31 14 13 31 19 30 31 31 22 34 25 33 33 33 30 24 29 30 18 24 24 11 11 24 24 33 39 34 34 30 30 34 22 22 14 19 18 23 23 17 31 24 37 33 33 33 33 33 28 34 18 18 27 34 34 38 27 20 20 24 24 30 30 39 34 34 30 22 22 24 33 33 33 33 28 24 24 22 30 22 24 24 33 33 33 39 51 51 41 32 27 17 25 17 31 31 34 19 15 10 10 31 14 27 21 30 30 24 24 30 34 39 39 41 36 34 30 30 30 34 31 16 9 9 10 20 19 16 11 9 9 9 13 23 22 28 28 37 33 33 33 28 32 18 13 10 20 18 10 32 21 31 23 14 9 9 9 16 11 9 9 10 20 25 33 30 30 28 32 28 28 37 35 35 34 34 34 34 34 37 40 37 33 32 25 12 10 10 16 16 28 32 32 34 30 28 28 29 31 33 32 28 30 30 25 21 16 19 19 19 27 19 14 14 22 22 28 25 29 29 29 30 30 23 23 21 18 14 21 17 24 19 32 32 37 37 31 30 30 28 31 30 34 34 28 28 28 28 31 31 30 28 28 28 30 30 25 32 10 10 10 23 23 27 17 17 22 17 23 23 23 24 20 17 4 4 4 14 16 24 22 19 18 13 19 9 12 14 25 25 33 32 29 40 38 49 49 49 34 34 17 14 8 7 7 9 9 10 8 7 7 9 10 15 17 18 22 24 18 18 18 22 20 24 24 28 18 19 18 19 21 24 25 14 12 8 8 9 14 12 4 4 4 17 17 17 14 9 9 9 12 21 21 18 12 10 13 10 11 9 12 12 8 7 8 8 9 10 9 15 10 8 9 10 10 21 21 28 27 18 14 7 7 Sequence : 22ak93c1.s1lt Is_read Padded Staden_id 1 Clipping QUAL 56 598 Align_to_SCF 1 648 1 648 SCF_File 22ak93c1.s1ltSCF Primer Universal_primer Strand Forward Dye Dye_primer Template 22ak93c1 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 47 "M13mp18" Tag DONE 541 541 "AUTO-EDIT: replaced N by g at 541 (all_stranded, isolated, strong)" Tag ALUS 559 647 Tag DONE 569 569 "AUTO-EDIT: replaced A by g at 569 (all_stranded, isolated, strong)" Tag DONE 571 571 "AUTO-EDIT: replaced A by g at 571 (all_stranded, isolated, strong)" DNA : 22ak64e2.s1t GTAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTTTGCAAAATGCTTGCTTA GGACCAGAAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTA CTGGTTGAATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCC TTTGAACATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGA TTTTCAGATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCA CTATATCAATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTAC TGTACTAGTTGTCTTGTCTCTGCTTTTTTTTTTTCGAGACAGAGTCTCACACTATTGGTT GGACTGGAGTGCAATTCnCCTGAATTCGGCTCACGGCAACTTCAACCTCCCGGGTTCAAG TGAATCTCCTC BaseQuality : 22ak64e2.s1t 4 4 8 10 12 15 18 18 28 30 30 30 30 26 37 34 30 30 22 22 20 23 16 11 11 18 23 23 23 28 9 9 10 9 21 12 32 34 45 45 45 45 38 30 30 30 30 30 28 34 30 33 33 33 33 33 43 45 45 32 18 10 11 11 25 23 10 10 22 32 38 37 27 27 27 23 20 9 9 10 23 25 25 21 9 9 10 29 32 45 45 45 45 45 45 37 37 37 38 45 37 41 28 29 28 28 28 28 34 34 33 33 33 28 28 34 33 34 34 34 34 34 34 45 37 37 29 37 37 45 45 45 45 42 37 34 35 35 35 34 34 34 34 34 37 37 37 45 45 35 35 35 35 35 35 35 37 37 37 37 45 37 42 42 33 30 30 33 33 33 40 34 34 34 34 34 34 40 40 40 37 37 37 34 34 34 34 34 31 31 27 28 19 21 19 28 28 30 32 34 34 31 31 31 33 39 27 20 7 7 8 8 14 15 11 11 17 28 23 28 17 9 9 11 23 27 33 33 40 40 40 40 40 40 40 37 32 32 31 31 28 37 30 33 25 21 13 13 14 26 22 11 11 21 21 30 33 31 31 33 37 37 37 45 49 45 40 40 40 40 40 45 40 40 40 40 40 31 29 29 32 27 37 37 45 45 45 40 37 37 37 37 37 33 34 33 33 30 30 34 34 36 36 36 30 30 28 28 28 27 38 38 36 31 33 32 27 20 20 20 28 32 33 24 24 29 36 34 30 33 30 26 26 26 30 30 26 37 36 34 33 30 31 31 28 27 27 25 24 29 33 27 27 31 31 31 31 33 36 38 38 32 32 21 13 13 16 19 19 24 25 33 30 33 33 33 38 39 40 44 40 40 36 33 37 40 40 40 40 49 40 36 33 31 26 23 23 21 18 20 14 12 11 14 17 25 31 33 33 33 36 30 30 30 30 30 28 28 20 15 14 4 4 4 12 9 9 4 4 4 7 8 7 7 7 7 4 4 4 7 8 10 7 6 9 9 9 7 7 11 17 19 9 8 7 7 8 7 8 9 7 6 10 6 7 6 6 7 7 8 8 8 12 13 8 8 8 8 10 10 9 8 7 6 6 8 13 7 7 7 7 Sequence : 22ak64e2.s1t Is_read Padded Staden_id 14 Clipping QUAL 41 420 Align_to_SCF 1 491 1 491 SCF_File 22ak64e2.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak64e2 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 40 "M13mp" DNA : 22ak70f10.s1t TTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCCAGGGTTATTATGATGATTAAATGAG AGAATAGCTGTGAGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTAT ACGGGTTGAGTGTTTCTAATCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACT TTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAG ATTTTTGGGTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAA ATCTGAAATCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCT GTAGTACGTTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGT GGTATAGCAAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAG GATTATTGGAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATnTTAGATAGAAA AGTGCAGTnTTTCAGTTCATGCTCTnTCATTTnTTACTCCCTCCGGTTAAAGCTGAAGCT CAACAAAGATATAGTGATCTCTGTGGGCATTATAATCCTGTCCC BaseQuality : 22ak70f10.s1t 4 4 6 8 8 9 19 23 33 33 34 33 27 21 18 27 18 27 27 34 34 31 27 23 13 11 19 16 31 31 37 45 45 34 34 31 31 22 31 25 31 37 45 45 45 45 37 37 37 37 37 37 45 37 37 37 45 38 29 27 27 32 32 37 45 33 37 37 45 37 45 45 37 37 37 40 40 40 37 45 37 37 34 33 33 34 34 34 37 33 40 37 37 37 33 33 33 33 33 33 33 33 33 32 33 41 41 35 35 35 40 40 36 36 36 34 33 33 37 37 37 37 37 41 45 30 30 41 41 37 28 45 18 18 29 35 37 37 37 37 41 41 51 51 51 51 51 33 33 33 33 33 33 45 45 45 41 39 39 51 51 41 45 45 45 45 35 33 33 33 33 33 40 51 51 51 51 51 51 51 51 51 43 45 39 34 30 30 33 33 33 33 45 45 38 38 38 38 33 30 29 14 15 27 27 30 33 51 51 41 41 37 34 37 37 37 40 40 40 37 45 51 33 33 33 33 33 33 37 37 31 45 33 25 22 27 21 28 33 28 28 33 41 37 45 41 33 45 33 22 22 33 33 34 44 44 45 45 33 33 33 33 33 30 34 34 34 34 37 37 29 34 37 33 33 33 33 33 33 34 40 33 33 33 30 30 30 37 37 37 30 30 33 30 33 33 49 49 45 45 45 45 45 45 44 38 38 38 44 38 45 45 49 40 40 35 35 35 35 38 37 40 37 37 34 34 34 34 34 34 34 36 36 36 34 36 33 31 31 36 33 28 28 27 23 19 17 17 23 23 23 33 27 28 28 28 30 33 40 40 31 31 17 20 20 28 32 25 17 17 32 27 37 37 36 33 33 33 33 32 36 34 28 30 32 31 31 14 18 10 9 9 19 21 30 31 38 38 38 37 37 31 34 34 36 31 30 31 31 31 31 33 33 33 39 30 25 24 24 29 33 33 34 33 33 23 23 12 23 23 30 33 33 37 37 37 38 40 37 34 33 37 36 33 33 33 33 33 33 36 28 28 22 24 24 24 21 29 33 33 33 34 33 33 33 33 33 33 33 33 33 27 28 28 31 31 23 27 19 15 11 20 21 33 33 31 31 31 31 31 26 28 24 24 24 29 24 29 29 33 27 31 27 30 36 29 18 20 12 17 9 9 9 19 19 15 8 8 13 15 14 8 9 9 9 10 12 4 4 4 9 10 11 12 24 26 18 13 13 11 11 13 10 16 14 13 12 4 4 4 17 11 7 7 8 7 8 8 8 20 20 26 16 14 4 4 4 8 8 10 18 4 4 4 8 8 21 11 13 10 8 10 6 6 6 6 6 8 9 12 14 17 11 14 14 8 8 8 7 9 7 8 8 12 9 9 8 8 7 10 10 12 10 9 8 16 9 8 8 8 7 6 6 8 6 6 6 6 6 6 6 9 12 7 7 8 8 7 7 7 12 8 7 7 Sequence : 22ak70f10.s1t Is_read Padded Staden_id 2 Clipping QUAL 35 508 Align_to_SCF 1 644 1 644 SCF_File 22ak70f10.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak70f10 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 34 "M13mp1" Seq_vec SVEC 584 644 "M13mp1" DNA : 22ak92c4.s1t nGGGCGCTGCCTGCAGGTCGACTCTAnAGGATCCCCATTATACGGGTTGAGTGTTTCTAA TCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAA TGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATAT TCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATT TCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCAT TGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTG TATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAA ACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCA TGCTCTTTCATTTC BaseQuality : 22ak92c4.s1t 4 4 6 4 6 8 11 14 18 26 32 34 36 34 23 25 10 23 9 23 23 34 29 23 22 4 4 4 16 14 25 24 29 33 30 33 33 33 33 40 37 40 45 28 28 25 15 18 32 32 17 14 28 13 13 38 38 40 40 37 37 37 37 38 45 45 45 38 33 32 33 33 33 33 38 38 38 45 32 30 45 32 34 34 34 34 40 33 33 32 32 28 28 38 45 45 49 45 45 45 45 40 37 41 45 45 40 30 30 33 33 33 33 40 40 45 45 45 45 32 32 28 11 12 27 25 33 33 45 41 33 32 14 14 28 33 37 37 37 37 37 45 45 37 37 37 37 37 37 37 37 28 33 32 21 14 32 20 24 32 21 21 32 36 41 41 45 32 32 28 13 13 33 33 45 51 51 41 37 32 32 32 32 32 32 34 34 30 30 31 32 12 12 27 31 30 35 35 35 33 39 41 28 28 28 28 28 28 41 41 41 30 32 30 30 30 32 51 51 51 51 45 45 45 45 45 45 45 45 51 45 45 45 45 33 33 33 33 33 33 51 51 51 51 51 41 41 45 45 45 39 39 39 39 39 39 41 41 41 41 40 33 33 33 33 33 33 41 45 41 41 41 41 33 33 33 33 33 33 51 51 45 34 22 22 20 28 30 17 15 15 45 30 33 33 33 33 33 33 33 33 37 37 32 33 33 25 25 9 10 9 14 14 33 33 34 34 41 40 40 40 40 37 40 37 37 34 33 33 29 24 22 32 32 45 45 40 27 27 14 32 32 45 38 34 45 19 21 10 21 21 30 37 37 34 34 37 38 38 37 37 37 37 37 35 34 36 36 40 40 49 34 34 34 34 37 37 38 37 33 30 30 30 30 30 40 40 34 34 34 27 27 31 31 33 35 33 30 30 21 21 12 30 28 36 40 36 36 36 33 33 26 26 21 19 20 29 30 36 34 34 33 31 28 28 32 35 32 35 26 30 25 26 26 25 21 19 12 11 19 21 23 21 11 13 17 17 24 29 27 29 29 28 31 20 25 18 16 12 14 23 21 11 11 16 14 10 21 23 33 33 34 31 31 22 22 14 21 11 16 18 31 40 40 36 36 24 27 19 19 13 16 10 8 Sequence : 22ak92c4.s1t Is_read Padded Staden_id 16 Clipping QUAL 37 490 Align_to_SCF 1 494 1 494 SCF_File 22ak92c4.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak92c4 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 36 "M13mp1" DNA : 22ap08f1.s1t GAACTATCATnnnATATACGGGTTGAGTGTnTCTAATCTGAAAATCCAAAATTAGAAATG CTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGA GCATTATGGGTTGTTAgATTTTTGGGTtGGGAATATTCAACCATTAAGCTACACACAATG CAAATATCCCACAAACAATCTGAAATCTGAAACACTTCTGGTCCAAGCAAGCATCCGCAA CGGATACGCAACCTGCACACGTTCTTATCATCGTTAACTCTnATATATGTGGACAAATCT GACGTGGTACACACACTCATGTATATCACAACATATTACATTTGAAGCTGCTACGAATAT GGAAGAATnnnnCCTGAACTTGGTGTATGACGAACTTAGATAGACAGTGACTCTTCAGTT CAGCTCnTCATTTnTnnTCCCTCGGTTTTnCTAAnCnCnnCnnAAAAnnnnATCCnGTGG GCATAAAnnCnGGTCCCACCGCCCCCnCCCCACAAAACCACACACTACCGACCTCCCAA BaseQuality : 22ap08f1.s1t 7 9 10 13 14 16 21 15 14 4 4 4 4 4 11 11 20 26 28 28 30 30 30 25 25 20 25 23 28 4 4 4 18 18 18 21 24 31 33 34 33 34 34 40 30 31 30 24 24 24 31 27 30 31 30 23 32 32 37 36 38 34 33 24 18 15 10 8 8 18 25 32 33 34 31 31 33 29 21 12 9 7 8 11 13 18 22 25 25 33 33 32 29 22 27 24 25 16 9 9 19 21 20 14 16 10 12 12 11 11 18 23 21 19 19 10 10 10 20 9 9 13 18 18 20 21 18 17 14 16 9 9 9 10 10 10 9 9 21 25 22 18 18 14 20 21 13 13 21 17 26 25 23 20 15 10 12 16 17 15 10 11 8 8 8 8 6 4 4 4 8 10 8 8 6 6 8 13 15 21 21 15 11 9 12 11 7 6 6 6 6 6 6 10 6 6 6 6 10 14 10 10 9 12 9 11 10 14 9 13 10 10 12 9 9 15 17 20 16 17 21 25 10 8 10 10 7 7 10 9 7 8 14 7 7 8 10 8 6 6 6 8 8 10 11 14 8 9 11 19 17 13 9 9 9 8 8 10 9 8 8 8 9 8 11 11 10 8 8 8 8 6 6 8 10 8 7 6 4 8 4 4 4 7 7 11 10 12 9 12 10 10 10 11 6 6 9 9 14 8 7 7 7 7 12 16 11 6 6 6 6 6 6 6 6 6 8 13 9 8 8 15 12 10 9 8 8 8 8 7 9 12 8 6 6 8 4 6 6 7 11 13 13 7 8 9 7 7 12 12 10 9 4 4 4 6 7 7 12 14 7 7 12 6 6 6 7 4 4 4 4 4 4 8 8 14 12 13 16 16 16 10 11 16 14 12 7 6 6 4 4 4 8 7 7 7 12 7 7 8 11 4 4 4 4 4 6 6 6 6 6 6 6 6 6 4 4 8 6 6 12 12 12 9 8 4 4 4 6 11 6 9 4 4 4 4 4 4 9 9 9 15 9 9 6 6 6 8 4 4 4 9 9 4 4 4 4 4 4 4 4 4 4 4 9 9 4 4 4 4 4 4 11 12 4 4 4 8 8 15 9 6 8 9 9 9 4 4 4 4 4 4 7 10 6 8 15 8 8 4 6 14 15 17 18 4 4 4 14 8 6 6 8 8 9 13 9 9 9 7 7 7 7 8 8 6 6 8 6 6 6 8 6 6 8 8 8 8 4 Sequence : 22ap08f1.s1t Is_read Padded Staden_id 17 Clipping QUAL 17 155 Align_to_SCF 1 539 1 539 SCF_File 22ap08f1.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ap08f1 Clone bK216E10 Sequencing_vector "m13mp18" Tag DONE 137 137 "AUTO-EDIT: replaced T by g at 137 (terminated, isolated, strong)" Tag DONE 148 148 "AUTO-EDIT: replaced A by t at 148 (terminated, isolated, strong)" DNA : 22ai01c4.s1t GGAACATGCTGCAGGTCGACTCTAGAGGATCCCCGCTCTACAGTCTGAAACTTTTTTGAG CACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGG GTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAA TCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACG TTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGC AAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTG GAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGT TTTTCAGTTCATGCTCTTTCATTTTTTACTCCCTCAGGTTAAAGCT-GAAGCTCAACAAA GATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTCAAGCCTCCTCCA ATAAAGCTCTATCGGGAAACAAATGAAACAGTGAAAACCAAGAACCGGAACTTTAATACA AGTACAGGCGGTTTGCTTTCTGCTAGCGATACCAAAAGTCTCAGGTAGGTAAAAATGCTn nTGTGTTA BaseQuality : 22ai01c4.s1t 4 4 6 8 8 18 18 25 25 30 25 21 27 16 16 27 24 27 31 37 33 33 31 31 21 21 23 25 37 34 37 45 45 45 45 40 40 40 33 33 30 30 30 30 38 45 45 49 45 45 45 45 45 45 45 45 38 38 30 30 30 33 33 30 37 37 40 42 42 45 38 45 35 25 27 33 33 33 33 37 37 37 40 37 37 37 37 42 42 42 40 37 40 45 33 33 33 33 33 33 45 45 41 41 45 37 30 41 32 41 45 37 37 41 41 45 45 41 32 38 37 30 30 30 41 41 51 51 51 51 33 33 35 35 35 29 33 33 33 33 33 45 37 37 37 37 37 40 40 40 40 45 43 35 33 33 33 33 33 43 45 43 32 33 33 28 28 29 51 51 45 51 51 51 51 51 51 51 51 51 51 51 51 51 51 42 42 42 40 39 39 51 51 45 45 45 38 38 37 37 38 33 33 33 33 33 33 37 40 39 39 42 33 33 33 33 33 33 37 37 41 41 41 41 33 33 33 33 33 33 51 45 41 41 39 34 34 29 31 37 34 34 45 37 38 42 33 32 32 32 32 32 37 51 32 32 32 32 32 21 24 12 25 25 33 33 33 33 40 40 40 37 37 41 45 45 45 35 34 34 34 34 34 41 41 45 45 45 41 37 37 41 40 45 37 37 42 33 33 22 33 33 33 37 37 37 37 37 37 37 37 37 36 33 33 33 33 33 33 40 40 45 34 34 34 34 34 34 37 37 40 33 33 33 33 33 36 36 40 34 37 37 37 37 38 38 36 33 33 33 31 31 20 29 27 34 34 34 40 40 34 34 38 38 38 34 34 40 37 40 37 30 30 30 30 30 34 36 40 40 36 36 28 33 32 27 27 18 14 14 18 23 27 34 33 29 29 24 29 29 27 27 28 28 25 25 33 22 24 23 31 28 33 34 31 25 25 25 25 30 31 36 32 27 18 13 13 25 25 17 23 25 31 45 45 45 38 31 31 24 22 20 27 35 34 31 33 33 33 33 36 36 36 38 20 13 10 8 12 11 18 20 23 34 34 30 1 29 22 19 24 22 24 28 31 31 31 27 27 23 28 10 25 20 17 10 25 25 35 35 38 38 36 36 27 27 17 17 11 13 16 19 18 18 18 22 15 11 11 15 27 25 24 24 18 8 9 8 7 7 8 7 8 8 15 17 21 14 10 10 19 17 20 25 24 24 21 16 15 21 21 26 33 33 26 23 19 23 23 28 21 20 15 10 8 7 8 6 8 11 7 10 18 17 12 9 9 7 11 9 7 6 7 6 8 9 9 9 6 10 8 10 7 8 8 7 6 6 8 7 8 8 14 23 24 19 14 14 7 7 7 7 8 8 6 6 7 6 6 6 6 6 9 21 13 12 13 15 15 10 11 17 16 15 8 7 7 9 9 10 10 8 8 8 8 9 8 6 8 8 8 7 7 7 7 7 7 7 7 7 7 7 10 8 7 7 8 11 4 4 4 4 9 6 6 6 6 6 Sequence : 22ai01c4.s1t Is_read Padded Staden_id 6 Clipping QUAL 35 553 Align_to_SCF 1 466 1 466 Align_to_SCF 468 668 467 667 SCF_File 22ai01c4.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ai01c4 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 34 "M13mp18" DNA : 22ak93c1.s1t nGGTGAAGCTTGCATGCCTGCAGGTCGACTCTAAAGGATCCCCACAcCAAAGCTTCACTG TTTTATTCTCTCCAATAATCCTAAgCAAGCTCTCAAAATATAAATATGCTTTtTAATAAT ACAATCGAATTTGCTATACCACCTCAGAATCTGTACCACAATATATTAACTACTTAAAAC AATGATAAAGAACGTACTACAGGTTGCGTATCCCTTTGCAAAATGCTTGCTTAgGACCAG AAATGTtTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTACTGGTTG AATATTCCCAACCCAAAaATCTAACAACCCATAATGCTCCAATAAGCACTTCCTTTGAAC ATTATGTCGGTGCTCAAAAAAGTTTCAGACTGTAAAGCATTTCCTAATTTTGGATTTCCA GAATAGAAACACTCAACCCGTATAATAAAATGATAATCTGTATTAAGCACAGCACTATAT CAAGCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTACTGTACA AGTGGTCTGGTCCCTGCTTTTATTTCTCCAAGAACGACTCTCACACTATTGGTTCGCCTG GAGTGCnTCGCGTGATCCCCGCTCATGGCACCTCCACTCCCGGGTCCAAGCAATTCTCTT GCTCAACTTCCAAGTGGTGGGATTAGGGCCCTGCCATAACCCACTTATTTCTTTTATTTT AATAAAACGTTTCCCCATTTTGGCAGTGGGTTTTACCCTGACCCGTATTGCCCTTCCGGC CCACGATTTGGGGGAACCAGTTGGGCCCCCCTTTGGGCCTCTCCTGTTCCGAGC BaseQuality : 22ak93c1.s1t 4 4 4 4 8 8 12 20 25 31 33 33 30 30 30 31 31 35 35 34 27 23 12 11 25 11 14 14 28 32 20 14 6 6 6 6 8 16 16 25 28 15 15 13 17 9 10 9 16 16 18 18 18 25 27 30 26 20 21 19 10 10 14 23 25 30 30 37 37 37 34 31 28 30 22 18 29 18 22 18 15 11 21 12 15 15 22 24 28 37 37 37 37 32 27 10 10 13 18 20 25 25 23 23 24 32 33 40 40 38 32 18 18 18 27 27 28 37 37 21 21 15 15 12 22 32 23 23 30 30 45 45 37 37 32 32 23 22 22 22 27 28 31 26 23 12 12 18 32 38 37 37 37 37 34 34 30 30 30 30 30 30 34 34 37 37 37 34 34 31 31 31 28 27 24 22 22 22 30 30 33 30 30 32 26 24 15 15 9 7 7 14 10 10 9 14 11 12 10 11 6 7 9 8 17 24 26 28 26 28 28 35 34 34 30 26 26 26 28 28 31 31 33 33 31 23 20 15 13 15 18 14 6 6 8 13 13 19 9 7 7 16 10 10 15 10 8 8 12 10 9 9 18 13 14 17 11 7 7 13 21 23 28 21 20 19 19 22 25 27 31 32 32 28 28 25 25 25 25 25 25 31 30 19 19 13 13 13 27 28 33 33 33 33 33 36 33 31 24 21 14 15 18 24 27 31 25 28 30 30 28 23 23 21 17 14 8 9 9 25 25 33 25 25 28 30 30 30 22 21 20 20 22 25 28 34 28 21 16 15 10 14 17 25 25 12 12 12 12 12 20 10 14 16 21 17 13 11 9 12 11 7 6 6 6 8 14 8 8 6 6 11 23 21 28 28 31 31 34 23 10 7 7 7 7 7 9 8 8 14 16 20 20 16 10 7 7 7 14 7 9 14 10 9 14 9 19 22 27 25 13 13 18 14 17 23 16 9 8 9 7 7 7 7 9 8 8 13 16 21 19 15 15 10 10 15 11 18 25 23 21 21 21 32 25 28 25 28 17 20 10 7 7 11 6 7 6 6 7 9 8 6 6 6 6 6 8 7 7 9 13 11 13 13 20 21 18 15 10 10 9 9 8 8 8 9 9 13 16 16 14 14 14 25 10 11 6 6 6 6 7 10 14 9 13 20 8 7 7 8 11 10 13 12 12 13 16 14 15 15 13 13 10 12 7 8 9 14 11 12 12 9 10 8 8 8 10 20 12 9 9 12 6 6 6 6 8 9 6 6 6 6 7 6 6 8 16 18 18 9 6 6 6 13 7 7 7 8 9 9 7 7 7 7 7 6 6 6 6 6 6 6 6 7 8 8 10 9 8 8 6 7 8 4 4 4 4 4 10 7 7 9 9 8 8 4 4 4 4 4 4 8 4 9 9 12 9 8 6 6 6 9 11 7 7 7 7 7 9 11 11 9 6 6 6 10 8 8 7 10 10 14 25 16 10 7 7 7 7 10 10 8 8 7 7 7 8 6 6 6 6 8 11 12 7 6 13 6 7 7 7 8 7 7 7 8 8 10 8 6 6 6 4 4 8 8 10 13 22 24 24 20 14 8 6 6 6 6 6 10 15 15 10 9 6 6 10 8 7 7 9 9 13 13 10 11 11 11 8 7 7 6 14 6 7 8 6 6 7 7 7 7 7 7 12 7 8 10 10 13 14 9 8 8 8 11 9 7 7 7 8 8 11 10 12 11 11 10 10 12 12 17 13 9 8 9 6 6 6 6 6 12 8 8 8 8 9 8 8 9 8 7 7 7 9 9 8 8 6 6 8 8 11 12 8 6 8 6 6 6 6 6 7 8 9 11 12 12 6 6 8 7 8 8 13 7 7 7 6 8 8 8 8 8 8 6 6 8 4 6 4 4 4 4 Sequence : 22ak93c1.s1t Is_read Padded Staden_id 10 Clipping QUAL 44 345 Align_to_SCF 1 834 1 834 SCF_File 22ak93c1.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak93c1 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 43 "M13mp1" Tag DONE 47 47 "AUTO-EDIT: replaced T by c at 47 (terminator, isolated, strong)" Tag DONE 85 85 "AUTO-EDIT: replaced C by g at 85 (terminated, isolated, strong)" Tag DONE 113 113 "AUTO-EDIT: replaced A by t at 113 (terminated, isolated, strong)" Tag DONE 234 234 "AUTO-EDIT: replaced C by g at 234 (terminated, isolated, strong)" Tag DONE 247 247 "AUTO-EDIT: replaced C by t at 247 (terminated, isolated, strong)" Tag DONE 318 318 "AUTO-EDIT: replaced G by a at 318 (terminated, isolated, strong)" DNA : 22ak65e10.s1t TGAGGGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAAAAAATAAATAAATAA ATAAATTAGCTGGGTGTGATGTCACATGCCTGTGATCCCAGCTACTTGGGAGGCTGAGAC AGAAGGATCGCTTGAGTCCAGGAGGTCAAGGCTGTAGCGAGTCATGTTCGCCCCACTGCA CTCCAGCCTGGGCGACACAATGAGACCCTGTCTCAAAAACAACAACAACAAAAGGCATCT CTACCTACCTGAGACCTCTTGGTATCGCTAGGCAGAAGCAAACCGCCTGTACTTGTATTA AAGGTCCGGGTCTTGGTTTTCACTGGTTCATTTGTTTCCCGATAGAGCTTTATTGGAGGA gGCTTGAGAGCCTTCTGGACCAGATTATaAATGCCCACAGAGATCACTATATCTTTGTTG AGCTTC-AGCTTTAACCTGAGGGAGTAAAAAATGAAAGAGCATGAACTGAAAAACTGCAC TTTTCTATCTAAAATTCCCTCATAACACCAAAGCTTCACTGTTTTATTCTCTCCAATAAT CCTAAGCAAGCTCTCAAAATATAAATATGCTTTTTAATAATACAATCC BaseQuality : 22ak65e10.s1t 4 4 8 8 9 9 14 15 31 31 28 28 28 30 30 33 33 33 30 22 20 12 22 12 18 18 30 31 27 23 32 10 10 14 12 32 32 37 45 45 45 45 45 38 34 29 29 29 29 29 29 29 32 32 30 34 34 34 34 35 34 34 32 35 29 27 32 32 32 37 45 32 45 37 37 37 24 24 32 32 19 22 11 21 21 31 31 34 45 45 45 28 30 30 37 40 34 33 33 28 28 28 37 45 41 41 41 41 45 41 27 27 33 37 37 32 27 20 20 20 30 20 20 21 24 17 38 32 30 42 37 37 37 30 28 13 12 18 25 21 24 14 25 25 22 28 17 28 28 18 32 36 36 32 32 21 32 32 31 31 27 27 21 32 32 27 13 13 32 33 38 45 36 34 30 30 21 21 23 23 23 23 30 33 33 37 34 41 36 41 37 37 34 29 29 19 30 30 40 37 37 36 37 25 25 26 26 30 45 41 51 37 33 30 28 28 33 20 18 20 20 20 20 26 20 20 18 21 21 31 31 28 32 14 18 20 29 33 34 45 45 40 40 40 37 37 37 37 37 32 45 30 23 23 32 32 37 34 35 34 34 34 34 37 37 37 37 45 37 37 32 27 23 14 12 12 14 17 19 27 27 28 30 37 45 45 45 45 37 37 37 42 42 40 37 37 34 33 33 40 31 26 28 25 27 31 34 34 34 31 27 27 27 31 27 31 23 23 18 18 18 25 25 31 35 31 30 27 25 27 35 33 32 30 21 21 21 23 23 27 26 21 20 16 16 17 18 30 30 36 36 36 34 34 36 34 26 15 12 6 6 6 12 11 23 23 26 17 17 21 32 35 35 40 33 33 33 38 33 27 23 23 12 12 18 18 19 10 8 8 17 19 34 33 34 31 34 31 31 22 22 19 18 27 27 32 22 25 24 32 32 34 34 34 37 34 30 33 27 27 27 31 32 27 27 18 1 12 12 11 15 15 17 27 28 28 34 34 30 25 18 13 19 15 15 25 21 29 26 34 24 28 25 27 21 20 23 24 24 26 29 30 26 27 22 29 27 33 34 34 36 38 38 38 34 31 30 24 24 24 31 33 35 35 29 33 33 31 31 28 28 29 26 22 14 8 9 9 9 14 9 13 18 21 21 27 23 18 15 21 21 25 33 33 31 31 21 21 24 27 29 25 19 19 19 25 27 27 34 34 34 14 9 7 7 9 18 23 27 23 19 19 23 24 21 18 8 8 9 21 20 31 24 20 13 11 16 24 32 32 25 18 13 13 20 20 26 21 27 21 20 13 17 15 21 12 12 18 15 15 15 15 8 8 7 10 8 4 Sequence : 22ak65e10.s1t Is_read Padded Staden_id 4 Clipping QUAL 42 575 Align_to_SCF 1 426 1 426 Align_to_SCF 428 588 427 587 SCF_File 22ak65e10.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak65e10 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 41 "M13mp" Tag DONE 361 361 "AUTO-EDIT: replaced C by g at 361 (all_stranded, compound, strong)" Tag DONE 389 389 "AUTO-EDIT: replaced C by a at 389 (terminated, isolated, strong)" DNA : 22ak93c2.s1t CTGGGAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACTCATTTTCTGCCTGG TGTTTATTCTCATCCAAATTCGTATACATGCTCGGTGTGAATGGTTACTCATTATAGTAT ACAATCGACTTTCTCAAACGACCACACATGCTGAATATCTATACATGTGCTAGTTGGACC TCTGATTATCAACGTGAGACTGGTGGCGTATCCCTTTGCAAAATGCTAACAAAAGACCAC AAACGTGTCACATTTCAGAATTGCTTGGAATATTCGCGTGTATAGTACTTACTGGTTCAA GGGTCCAAAACATACCTCTACACACCATCCTGATTCCCTGGGACACTTCCTTTGAACATC ACGTCGGTGCTCAAAAAAGTGTCAGACTGTAGAGCATATCTGGTTTCGGAATGTCGAGAT AGAAGGTCTCAAGCCGTATAAATAAACGAGAGTCTGTATCAAGCACTGCAGGAGAATCAT AACCTCACAGCTATGCTCTCATGGAAACATCTCAATACACCTCGTAGTACTGTACTAATA GTCATGTCGCTGCTTTTTGTTnCCGACAACCAATCTCACGGATTGGTTCGGCCGGTTTGC ATCCCTGATTCCGATCATTGAAGGTCGAACTCCCGGTCCAAGCAATCTCCTGCCCCGGCT CCAGATGACGGGATTCTTGCCTTTCAACACCCCGGCTAATTCATCCTCTCCCTCGACACC GATTTCACGAAATGGGGGTCGGCCCCAACCCGAACATTTGTTTACTGGGTAAAACGGTTC CCCAGTTACCCGTTGGCCCACTCCTGGGCCATTAATTGCCTC BaseQuality : 22ak93c2.s1t 4 4 8 8 9 12 12 22 27 30 30 30 30 33 33 35 33 37 37 33 31 30 25 25 27 27 18 18 32 38 32 28 28 9 9 10 10 25 21 27 38 28 25 23 16 12 10 10 11 10 13 12 11 15 14 8 8 11 13 18 21 21 9 7 7 6 11 8 8 8 6 6 8 8 8 8 10 9 9 10 9 14 9 13 11 8 8 8 8 8 11 10 11 14 14 14 21 11 10 10 10 11 17 11 7 7 8 8 9 9 13 14 18 15 9 9 9 8 8 10 12 12 10 10 8 9 12 12 13 14 23 10 10 10 12 11 11 10 10 10 11 14 14 15 15 21 22 10 10 10 10 28 10 9 9 9 10 12 15 18 15 15 12 12 12 12 25 21 24 27 18 13 13 13 14 12 14 12 10 10 10 14 18 14 9 9 11 12 12 10 10 10 10 9 14 14 8 8 8 8 6 6 9 6 6 6 12 18 34 36 38 38 38 38 36 36 33 33 23 23 13 13 15 23 28 20 9 6 6 4 6 10 8 7 7 9 10 9 13 13 10 10 9 8 8 6 6 8 8 11 12 10 9 9 9 6 4 6 6 8 6 7 11 10 9 7 8 17 18 21 19 17 11 8 8 9 11 11 15 12 8 8 8 9 9 15 15 10 10 9 10 7 7 8 12 10 10 9 9 9 9 10 11 10 8 8 8 7 12 7 7 7 8 9 8 9 10 10 9 10 8 6 6 6 6 7 6 9 10 10 10 7 6 6 6 8 6 6 9 10 13 12 12 9 12 15 14 14 8 8 8 9 10 10 9 9 9 9 8 6 6 10 8 13 6 6 6 11 16 18 12 11 8 10 12 8 7 9 7 7 7 7 9 9 7 7 10 10 12 10 20 9 7 7 7 8 8 8 9 7 7 7 11 9 13 19 15 12 7 8 7 6 6 6 6 6 6 6 10 13 8 6 6 8 6 8 10 10 12 7 7 7 7 7 7 8 10 9 9 8 7 6 6 8 6 6 8 9 9 10 7 7 8 8 8 8 7 7 8 7 7 7 7 7 9 8 8 15 8 8 6 6 6 6 6 6 7 10 9 9 8 7 8 8 10 7 7 8 8 11 11 11 8 6 6 6 6 6 12 6 6 6 6 6 7 11 12 9 7 10 11 8 8 7 8 11 8 7 7 7 6 8 6 6 8 6 8 7 7 8 7 7 7 8 9 7 7 7 7 7 7 9 7 7 7 6 13 4 7 7 7 12 23 21 14 12 9 8 9 8 4 4 4 6 6 6 7 6 8 4 4 4 6 6 6 6 6 6 8 6 7 10 9 9 9 8 6 4 4 4 6 8 6 6 6 6 8 6 6 8 8 8 8 8 8 6 6 8 11 10 7 7 7 7 9 9 9 8 7 11 8 7 7 8 9 8 8 7 7 7 7 7 7 7 7 8 7 7 7 7 8 7 7 8 7 7 7 7 8 7 7 7 7 7 7 6 6 7 7 6 6 6 8 9 8 7 7 7 7 8 8 12 9 7 7 7 7 6 7 8 7 7 7 8 8 6 6 6 6 6 6 7 7 9 12 10 14 8 9 8 6 6 6 6 6 6 9 10 10 9 6 6 6 6 8 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 6 6 6 4 6 6 6 6 8 6 6 6 6 6 8 8 10 7 4 7 4 4 4 6 6 6 6 6 6 6 6 6 6 6 7 7 9 9 8 8 7 9 9 7 7 7 8 6 6 6 6 6 6 6 6 6 6 8 8 8 8 8 8 8 7 7 6 6 6 6 7 8 9 9 9 9 7 7 7 7 7 7 7 6 6 6 6 Sequence : 22ak93c2.s1t Is_read Padded Staden_id 13 Clipping QUAL 44 45 Align_to_SCF 1 822 1 822 SCF_File 22ak93c2.s1tSCF Primer Universal_primer Strand Forward Dye Dye_terminator Template 22ak93c2 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 43 "M13mp1" DNA : 22am84d9.s1 CAACCCGCACACCTGCACGTCGACTCTAGAGGATCCCCATAAATAAATAAATtAgCTGGG TGTGATGTCACATGCCTGTgATCCCAGCTACTTGGGAgGCTGAGACAGAAGGATCGCTTG AGTCCAGGAGGTCAAGGCTGTAGCGAGTCATGTTCGCCCCACTGCACTCCAGCCTGGGCG ACACAATGAGACCCTGTCTCAAAAACAACAACAACAAAAGGCATCTCTACCTACCTGAGA CCTCTTGGTATCGCTAGGCAGAAGCAAACCGCCTGTACTTGTATTAAAGGTCCGGGTCTT GGTTTTCACTGGTTCATTTGTTTCCCGATAGAGCTTTATTGGAGGAGGCTTGAGAGCCTT CTGGACCAGATTATAAATGCCCACAGAGATCACTATATCTTTGTTGAGCTTCAAGCTTTA ACCTGAGGGCAGTAAAAAATGGAAGAGCATGAACTGGCAAAATGCACTTTTCTATCTAAA ATTCC BaseQuality : 22am84d9.s1 4 9 9 9 9 10 10 9 9 9 9 10 10 10 8 8 6 6 10 8 11 12 15 14 13 15 11 11 11 12 14 10 10 10 17 23 31 31 21 20 13 21 11 10 10 16 14 14 14 23 11 11 10 10 10 11 11 12 32 18 23 23 32 32 34 37 34 37 37 38 27 18 18 17 24 30 32 32 10 10 11 23 23 38 37 37 37 37 37 37 37 37 37 37 32 32 22 22 22 32 28 40 37 37 37 45 32 32 28 22 22 12 16 16 32 32 37 37 37 37 28 28 28 32 32 30 30 27 29 29 34 37 37 37 37 37 37 37 37 37 28 22 20 30 30 29 37 34 37 37 37 37 37 37 37 37 37 37 37 45 45 37 37 37 37 45 37 37 34 34 34 33 31 33 34 37 27 27 13 13 13 21 32 34 36 31 31 33 19 17 14 9 9 13 24 27 27 33 33 33 33 33 33 33 33 33 36 36 37 37 37 37 37 45 45 36 34 34 28 31 31 34 34 37 38 34 38 38 33 30 30 30 30 30 33 34 37 37 37 34 34 34 34 34 35 35 33 33 33 33 33 33 34 30 30 30 30 30 30 33 33 30 30 30 34 34 34 34 31 31 31 36 36 34 31 17 13 8 8 15 18 27 31 28 28 28 28 28 30 31 35 35 34 34 34 34 33 33 33 34 34 38 38 38 37 32 28 22 19 19 25 27 37 30 30 30 28 28 28 38 37 34 34 37 31 31 25 24 28 30 30 28 28 28 28 28 28 34 34 34 33 33 31 31 27 24 18 15 18 18 23 23 28 27 22 18 11 11 16 21 24 33 34 23 23 8 8 9 12 14 17 20 20 20 25 25 27 27 23 16 11 15 14 9 9 19 17 18 22 18 11 11 11 12 17 18 31 31 31 31 27 27 33 29 22 18 17 17 20 20 17 13 11 11 11 6 8 14 17 22 22 25 25 20 20 20 17 14 4 4 4 14 15 21 22 18 11 12 7 7 7 7 7 12 21 18 15 13 9 9 15 12 8 6 6 6 6 9 6 6 6 12 14 13 13 17 21 21 24 21 22 18 14 18 16 14 14 10 6 7 6 13 8 8 7 Sequence : 22am84d9.s1 Is_read Padded Staden_id 7 Clipping QUAL 39 427 Align_to_SCF 1 485 1 485 SCF_File 22am84d9.s1SCF Primer Universal_primer Strand Forward Dye Dye_primer Template 22am84d9 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 38 "M13mp18" Tag ALUS 41 210 Tag DONE 53 53 "AUTO-EDIT: replaced C by t at 53 (all_stranded, isolated, strong)" Tag DONE 55 55 "AUTO-EDIT: replaced C by g at 55 (all_stranded, isolated, strong)" Tag DONE 80 80 "AUTO-EDIT: replaced C by g at 80 (all_stranded, isolated, strong)" Tag DONE 98 98 "AUTO-EDIT: replaced C by g at 98 (all_stranded, isolated, strong)" Tag AMBG 338 360 "AUTOEDIT: Check this edit cluster!" Tag CONF 413 413 "AUTOEDIT: possible compression" DNA : 22ak66f10.s1lt CCCGCGGGGGAGGAGGGAnGGGGGGAGAGGAGnAnAAnnnnnnnnnnnnnAGCCCCAAnn nAnnCCCTCTTnnnnnnnnAGACGGGGGGnGCCCTGGGnGnGCnTnnnnnnnnnnTTGGT TGAGGTGnCGAGCAAATCTTGCATGCCTGtcCGTCTACTCtAGAGGATCCCACAAATGAA CCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGC GATACCAAGAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTTGTTTTTGAGACAGG GTCTCATTGTGTCGCCCAGGCTGGAGTGCAGTGGGGCGAACATGACTCGCTACAGCCTTG ACCTCCTGGACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGCTGGGATCACAGGCA TGTGACATCACACCCAGCTAATTTATTTATTTATTTATTTTTTAAGAGACTGGATCGACT GGGCACAGTGGCTCATGCCTGTAATCCCAnCACTTTGGGAGGCCGAGGCAGGTGGATTAC CGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCCATCTCTACTAAAAA TACAAAATGAGCTGGGCATGGTGGTGCATGCCTGTAATCCCAGCTACTCCGGAGGCTGAG GCAnGAGAATCCCTTGAACCCGGGAGGCAAAAGTTGCGGTGAGCCGAAATCTCGCCATTG CGCTCCAGCCTGGGCAACAAAAGCGTAACTCCGTCTCCnnnnnnnnAAAAAAAGAGACGG TGTTTCGCTATGTTGCCTGGGCTGGGTGTCAAACTCCTGGGTCTTAAAGTAATCCCCCCC TGCTTTGGGTTCCCCCAAATTGCTGGGGGTGGCTGGGATTCCCGAACTTTGGGGCCACTG TTGCCCCAGCCGTTTTTTTGGTTTCGTTTTGGTTTTGGTTTTGTTTTAATAAAAAAATAA AGGGTCTCACCTATGTT BaseQuality : 22ak66f10.s1lt 6 6 4 6 8 8 11 8 8 6 6 11 4 4 4 12 6 4 4 4 8 7 6 6 6 6 6 6 6 8 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 7 7 6 6 6 8 4 4 4 4 4 4 4 4 6 4 6 6 8 4 4 4 4 4 4 4 4 4 4 4 4 6 6 6 6 6 6 4 4 4 6 6 4 4 8 12 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 6 6 4 4 4 4 4 4 8 6 4 4 4 4 4 4 15 17 8 4 4 6 9 21 21 30 28 30 33 33 21 18 8 8 8 10 15 23 21 26 26 19 14 7 7 8 8 10 18 21 18 10 9 9 18 14 24 24 29 32 34 37 34 36 32 32 30 30 30 34 38 44 45 37 37 34 27 27 15 15 23 32 40 40 37 37 34 45 45 45 45 45 42 25 25 25 26 26 20 23 28 30 33 33 33 34 34 34 34 37 45 45 45 45 49 49 49 49 49 45 45 43 38 38 37 37 40 37 37 34 27 27 12 10 18 14 32 27 27 27 29 29 12 18 10 15 10 21 10 14 10 19 19 41 45 45 45 45 45 40 40 34 37 37 45 45 45 45 45 45 45 45 45 40 51 37 37 25 22 18 27 22 25 25 29 29 28 33 33 40 37 37 37 37 37 37 34 37 37 42 35 32 30 30 37 38 45 45 30 30 30 33 31 33 32 37 45 45 45 32 30 30 37 33 37 37 40 37 37 37 37 37 37 37 37 37 37 34 34 34 37 45 45 45 45 45 45 45 45 49 45 45 45 45 33 33 29 29 33 33 33 33 33 37 40 45 45 45 45 45 45 45 35 35 35 35 35 40 38 45 45 45 37 37 32 22 14 14 14 32 45 45 45 38 37 31 28 27 30 28 27 22 27 27 31 31 34 31 28 28 27 31 33 33 33 33 33 33 32 28 28 30 34 37 37 35 35 35 37 37 33 33 33 33 33 33 31 31 30 30 33 31 31 36 33 33 33 34 25 25 10 10 10 19 19 34 34 34 34 31 31 34 34 36 38 30 30 26 23 30 31 34 32 45 37 37 37 37 33 33 40 40 40 36 33 31 31 31 33 33 23 22 4 4 4 18 23 32 34 36 36 32 28 21 21 21 29 20 28 25 24 18 25 21 27 27 32 32 34 31 31 34 37 37 37 37 32 32 10 21 10 25 28 32 29 34 28 31 27 27 28 22 22 27 29 32 32 37 37 37 37 37 37 37 37 35 34 34 34 31 27 27 19 19 30 34 37 38 34 34 34 34 34 40 38 38 38 38 37 37 37 35 35 32 28 28 28 30 30 30 33 30 30 22 22 22 32 32 35 35 34 34 35 35 34 37 37 38 30 24 24 24 24 24 31 38 38 32 27 27 27 35 25 18 12 9 9 11 21 23 18 12 6 6 8 8 8 9 10 17 10 14 8 9 8 7 4 4 4 16 14 14 12 15 8 8 11 15 14 25 25 25 28 33 33 33 21 29 7 7 7 8 8 7 8 9 9 8 11 24 22 31 25 23 23 15 13 10 7 9 9 8 8 12 7 7 7 16 11 18 14 25 25 22 19 16 17 14 8 9 10 13 15 27 28 31 23 22 14 14 13 15 15 23 21 8 8 6 6 6 6 9 18 20 28 22 22 20 17 14 9 4 4 4 4 4 4 4 4 4 4 16 10 13 20 23 23 12 9 9 9 17 10 9 7 8 6 6 8 4 4 7 12 13 14 7 8 8 8 8 8 18 21 16 9 10 9 7 9 7 9 8 10 7 7 7 12 9 9 7 7 8 8 6 6 8 8 8 6 8 6 6 6 6 7 6 11 6 8 6 6 6 6 6 8 9 9 8 9 12 8 8 8 7 8 8 7 8 6 6 6 9 8 6 6 6 10 13 11 7 9 7 7 7 7 7 8 9 7 7 9 9 7 4 4 4 7 11 7 7 9 8 7 6 6 6 6 6 8 8 10 9 8 8 6 6 6 6 7 6 6 4 4 4 4 8 6 8 13 16 20 8 8 7 7 7 7 7 7 7 8 12 8 8 6 6 6 6 6 6 6 6 6 6 9 8 8 6 6 6 8 6 9 14 9 9 8 9 7 6 6 8 6 6 8 7 6 6 8 6 6 7 7 7 7 7 7 8 8 4 4 Sequence : 22ak66f10.s1lt Is_read Padded Staden_id 9 Clipping QUAL 140 640 Align_to_SCF 1 977 1 977 SCF_File 22ak66f10.s1ltSCF Primer Universal_primer Strand Forward Dye Dye_primer Template 22ak66f10 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 3 "M13mp18" Tag DONE 150 150 "AUTO-EDIT: replaced C by t at 150 (all_stranded, compound, strong)" Tag DONE 151 151 "AUTO-EDIT: replaced G by c at 151 (all_stranded, compound, strong)" Tag DONE 161 161 "AUTO-EDIT: replaced A by t at 161 (all_stranded, compound, strong)" Tag ALUS 283 462 Tag ALUS 477 767 DNA : 22ak70h4.r1t TGCCGCCTTAGATTACAGCTCTACACGGTACCTCTATCGGGAAACAAATGAACCAgTGAA AACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAA GAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTTGTTTTTGAGACAGGGTCTCATT GTGTCGCCCAgGCTGGAGTGCAGTGGGGCGAACATGACTCGCTACAGCCTTGACCTCCTG GACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGCTGGGATCACAGGCATGTGACAT CACACCCAGCTAATTTATTTATTTATTTATTTTTTAAGAGACTGGATCGACTGGGCACAG TGGCTCATGCCTGTAATCCCACCACTTTGGGAGGCCGAGGCATGTGGATTACCGAGGTTC GGAGTTCAAGACCAGCCTGACCCTTCTGGAGAAACCCCATCTCCACTTTAAATACCAAAT GAAGCTGGGCCTGGTGGTGCCTGCCTGTAATCCCCCCTTCTCAGGATGCTGAAGCAGGAC ATTCCTTGAACCCCGGAAGCACATGTTGCCGTGACCCAATATCCCCCCTTGTCCCTCACC CCGGGCCACCAAACCTTATTCCCTCCCAAATAAAAAAAAAAAAAAACGGGTTCCCTTTTT TGCCGGGGGGGGTTTCTACCCC BaseQuality : 22ak70h4.r1t 4 4 4 4 4 8 6 6 8 8 12 6 7 11 13 12 6 6 6 6 6 6 9 10 10 10 21 21 26 31 27 27 13 14 11 11 11 12 19 20 27 18 18 23 23 16 10 10 14 28 18 18 11 11 9 9 9 10 10 10 21 21 27 23 18 10 9 9 14 18 32 31 37 34 28 28 22 19 19 27 24 21 18 17 9 9 12 19 24 28 30 30 30 33 33 30 30 37 40 40 45 37 41 41 44 44 45 32 42 37 32 32 32 32 37 31 31 33 21 21 11 10 22 18 32 24 27 27 27 27 11 14 10 23 12 23 9 10 10 18 11 25 25 34 45 37 37 34 34 34 34 34 34 34 33 33 33 34 34 34 34 33 34 28 31 25 21 23 21 21 13 13 15 15 17 23 21 26 26 31 28 32 23 23 12 22 25 21 19 9 8 8 17 21 23 23 20 18 17 27 23 21 27 30 38 38 28 28 17 17 13 18 19 27 25 25 28 28 28 28 25 31 26 26 18 15 13 9 9 15 19 23 25 31 36 36 36 36 36 36 36 36 24 19 12 13 18 24 31 31 29 29 31 29 29 33 36 40 44 36 33 34 34 37 36 36 45 45 34 30 28 28 28 22 32 24 22 22 32 32 36 37 27 27 14 25 25 29 23 22 19 17 19 19 24 25 27 24 18 18 16 16 16 24 22 30 30 28 28 30 27 27 23 20 22 25 25 25 21 22 21 16 14 19 17 17 19 20 17 11 11 11 11 12 24 24 22 20 34 17 17 23 23 31 34 27 27 17 13 15 27 27 34 31 31 24 22 19 16 16 15 32 23 27 18 9 9 9 13 9 14 20 22 21 21 19 17 14 8 6 6 8 8 9 11 14 8 7 11 15 14 9 9 9 12 8 10 6 8 8 6 4 4 4 14 15 23 21 13 13 11 13 11 11 6 8 8 6 6 6 7 6 6 6 6 7 6 6 11 15 17 27 20 17 17 13 21 13 14 4 4 8 6 6 6 6 8 6 8 11 7 8 8 10 10 19 24 16 16 9 9 12 7 7 8 8 8 8 6 6 11 15 11 10 9 9 11 14 15 11 8 7 7 7 7 12 9 10 10 8 8 14 10 10 18 21 21 18 16 10 9 11 9 9 14 10 10 8 8 9 8 8 12 14 10 10 11 11 10 9 8 7 7 7 7 4 4 4 12 10 14 10 8 14 6 6 6 7 6 6 6 6 6 10 8 9 7 7 7 9 14 15 10 10 10 10 9 8 13 8 4 4 4 4 4 6 6 12 6 6 10 8 8 8 6 9 12 7 6 6 6 8 8 9 7 7 7 8 9 8 8 6 6 6 6 6 4 6 6 6 6 7 8 8 6 6 8 8 8 8 9 9 8 10 11 9 8 8 8 8 6 6 11 9 9 10 9 12 8 6 6 6 10 12 10 10 8 8 8 7 10 13 8 13 19 18 13 6 6 6 6 8 6 7 12 7 7 10 10 7 7 7 7 7 7 9 13 6 10 7 7 12 11 7 6 6 6 6 8 8 8 4 Sequence : 22ak70h4.r1t Is_read Padded Staden_id 15 Clipping QUAL 28 377 Align_to_SCF 1 682 1 682 SCF_File 22ak70h4.r1tSCF Primer Universal_primer Strand Reverse Dye Dye_terminator Template 22ak70h4 Clone bK216E10 Sequencing_vector "m13mp18" Seq_vec SVEC 1 27 "M13mp18" Tag DONE 56 56 "AUTO-EDIT: replaced C by g at 56 (all_stranded, isolated, strong)" Tag ALUS 155 334 Tag DONE 191 191 "AUTO-EDIT: replaced T by g at 191 (all_stranded, isolated, strong)" Tag ALUS 349 579 Sequence : Contig1 Is_contig Padded Assembled_from 22ak93c2.r1t 1 293 39 331 Assembled_from 22ak93c1.r1ta 1 305 31 335 Assembled_from 22am91h5.r1t 110 439 32 361 Assembled_from 22aq40a8.s1 221 570 39 388 Assembled_from 22an02b10.s1t 252 666 32 446 Assembled_from 22ak67d6.r1t 260 522 30 292 Assembled_from 22ak64b1.s1t 331 707 40 416 Assembled_from 22ak81h10.s1t 331 713 36 418 Assembled_from 22ak66c6.s1t 337 848 37 548 Assembled_from 22ak93c1.s1lt 1024 482 56 598 Assembled_from 22ak64e2.s1t 866 487 41 420 Assembled_from 22ak70f10.s1t 554 1027 35 508 Assembled_from 22ak92c4.s1t 635 1088 37 490 Assembled_from 22ap08f1.s1t 639 777 17 155 Assembled_from 22ai01c4.s1t 682 1200 35 553 Assembled_from 22ak93c1.s1t 1036 735 44 345 Assembled_from 22ak65e10.s1t 1499 966 42 575 Assembled_from 22ak93c2.s1t 1036 1035 44 45 Assembled_from 22am84d9.s1 1488 1100 39 427 Assembled_from 22ak66f10.s1lt 1174 1674 140 640 Assembled_from 22ak70h4.r1t 1190 1539 28 377 DNA : Contig1 TTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAnACTGTGCGTGCGC CACCATGCCTGGCTAATTTTTGTATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAA GCTGGTCTCGAGCTCCTGACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGG GTCTTTATTCTTCAAAGCAGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACAT GGTAGCTCACACCTGTAATnnnnnCACTTTGGGAGGCCAGTGCGGGTGAATCACGAnGTC AGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAnCACCGTCTCTACTAAAATAAAAAGA AATTAGCTGGGTGTCGTGGCAGGTGCnTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGG AGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTC CAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACnACT AGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTG ATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTnTCTAATC TGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATG TTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTC AACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATTTC TGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCATTG TTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTGTA TTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAAAC AGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCATG CTCTTTCATTTTTTACTCCCTCAGGTTAAAGCTnGAAGCTCAACAAAGATATAGTGATCT CTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTnnAnnCnnnTCCnnnnnnnCTnnAnn nnnnnACAAATGAACCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTT TGCTTCTGCCTAGCGATACCAAGAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTT GTTTTTGAGACAGGGTCTCATTGTGTCGCCCAGGCTGGAGTGCAGTGGGGCGAACATGAC TCGCTACAGCCTTGACCTCCTGGACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGC TGGGATCACAGGCATGTGACATCACACCCAGCTAATTTATTTATTTATTTATTTTTTAAG AGACTGGATCGACTGGGCACAGTGGCTCATGCCTGTAATCCCAnCACTTTGGGAGGCCGA GGCAGGTGGATTACCGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCC ATCTCTACTAAAAATACAAAATGAGCTGGGCATGGTGGTGCATGCCTGTAATCC
// models.wrm - main file defining tree class structures
// This file is read only when starting a new database or when you select
// "Read Models" or "Add Update File" from the main menu.
//
// all tags must appear in tags.wrm or systags.wrm
//
// Magic tag2 construct, such as Inside xxx ?AA
// denotes a case where Inside and ?AA are read by the display code
// whereas the intermediate xxx is up to the schema designer
//
// $Id: gap2caf.doc,v 1.8 1997/10/29 16:21:45 badger Exp $
//
// @ is for Attach-Query
?Clone Main_clone // Clone for project
// Contains default info on sequencing vector etc
Subclone ?Clone XREF Subclone_of
Subclone_info Subclone_of ?Clone XREF Subclone
Read ?Sequence XREF Template // Reads from this clone
Gel ?Motif #Lane // Restriction map
Stolen_reads ?Sequence XREF Stolen // for neighbouring cosmids, not Main_clone
Vector Cloning_vector UNIQUE ?Sequence UNIQUE Int // Int is cloning site position (default 1)
Sequencing_vector UNIQUE ?Sequence UNIQUE Int // Default sequencing vector; Int is cloning site position (default 1)
#Lane UNIQUE Bands UNIQUE Float REPEAT // In base pairs: if you prefer to minimise the ace format
Band_Lengths UNIQUE Float REPEAT // in mm: if you prefer to minimise the ace format
Band Float Text // if you wish to comment single band value
?Sequence DNA UNIQUE ?DNA UNIQUE Int // Int is the length
Position UNIQUE ?BasePosition UNIQUE Int
Quality UNIQUE ?BaseQuality UNIQUE Int
Type UNIQUE Is_read
Is_contig
Is_assembly
Is_vector
Padded_state UNIQUE Padded
Unpadded
Structure From Source UNIQUE ?Sequence XREF Subsequence
Subsequence ?Sequence XREF Source UNIQUE Int UNIQUE Int
Assembly Assembled_from ?Sequence XREF Assembled_into UNIQUE Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int
Assembled_into ?Sequence XREF Assembled_from
// these two are the binding relationships reads <-> contigs - they are loose
// the first two ints are the positions in the contig. The next two are the left and right clip points
// for the read with respect to this assembly.
Sequencing_vector UNIQUE ?Sequence UNIQUE Int // Int is cloning site. Overrides default from Main_clone
Library ?Library UNIQUE Text UNIQUE Text // Texts are ID, Accession_number
// to be used for reads from EMBL etc.
Properties EST
Stolen UNIQUE ?Clone XREF Stolen_reads
Base_caller UNIQUE Text
Staden_id UNIQUE Int
ASP Asped UNIQUE DateType
ProcessStatus UNIQUE Text
Features Tag ?Method Int COORD Int COORD Text
Seq_vec ?Method Int COORD Int COORD Text
Clone_vec ?Method Int COORD Int COORD Text
Clipping ?Method Int COORD Int COORD
Read Template UNIQUE ?Clone XREF Read
Dye UNIQUE Dye_primer
Dye_terminator
Strand UNIQUE Forward
Reverse
Primer UNIQUE Universal_primer
Custom UNIQUE Text // text may be the oligo - or should it be an object?
Insert_size UNIQUE Int UNIQUE Int
SCF_File UNIQUE Text
// for acembly: absolute file name, or relative to $SCF_DATA, or to $ACEDB/SCF
Align_to_SCF Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int
// tight alignment of current (edited) read to SCF file
Homol DNA_homol ?Sequence XREF DNA_homol ?Method Float Int COORD UNIQUE Int COORD Int UNIQUE Int
Feature ?Method Int COORD Int COORD UNIQUE Float UNIQUE Text
// Float is score
// Text is shown on select, and same Text are neighbours
?Method Remark ?Text // need this to enter Homol data, but caf does not need display info
GAP_tag UNIQUE Text
// ?Motif to read in restriction enzymes
?Motif Match_sequence UNIQUE Text // idem for ace4
Restriction_Enzyme Isoschizomer ?Motif XREF Isoschizomer
Offset UNIQUE Int
Cleavage UNIQUE Text // will show the cleavage points ex: G_ACGT'C
Overhang UNIQUE Int
Company UNIQUE Text
Remark Text
Substrate UNIQUE DNA
Peptide
// tag type - name is 4-letter code
// ?Tag_type Colour #Colour
// Description UNIQUE Text