FH Key Location/Qualifiers FH FT CDS 517..1878 FT /class="1.2.1" FT /colour=2 FT /locus_tag="SAR0001" FT /gene="dnaA" FT /gene="dnaH" FT /note="Previously sequenced as Staphylococcus aureus FT chromosomal replication initiator protein DnaA FT SW:DNAA_STAAU (P49994) (453 aa) fasta scores: E(): FT 1.2e-161, 99.779% id in 453 aa. Similar to Bacillus FT subtilis chromosomal replication initiator protein DnaA FT SW:DNAA_BACSU (P05648) (446 aa) fasta scores: E(): FT 2.7e-95, 60.403% id in 447 aa" FT /product="chromosomal replication initiator protein DnaA" FT misc_feature 862..1803 FT /note="Pfam match to entry PF00308 bac_dnaA, Bacterial FT dnaA protein, score 678.90, E-value 1.5e-228" FT /colour=9 FT misc_feature 982..1005 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 1744..1803 FT /colour=8 FT /note="PS01008 DnaA protein signature." FT CDS 2156..3289 FT /EC_number="2.7.7.7" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0002" FT /gene="dnaN" FT /note="Previously sequenced as Staphylococcus aureus DNA FT polymerase III, beta chain DnaN SW:DP3B_STAAU (P50029) FT (377 aa) fasta scores: E(): 7.4e-137, 100.000% id in 377 FT aa. Similar to Bacillus subtilis DNA polymerase III, beta FT chain DnaN SW:DP3B_BACSU (P05649) (378 aa) fasta scores: FT E(): 6.6e-74, 54.617% id in 379 aa" FT /product="DNA polymerase III, beta chain" FT misc_feature 2159..2539 FT /note="Pfam match to entry PF00712 DNA_pol3_beta, DNA FT polymerase III beta subunit, N-terminal domain, score FT 222.50, E-value 6e-63" FT /colour=9 FT misc_feature 2564..2908 FT /note="Pfam match to entry PF02767 DNA_pol3_beta_2, DNA FT polymerase III beta subunit, central domain, score 220.50, FT E-value 4.2e-67" FT /colour=9 FT misc_feature 2912..3280 FT /note="Pfam match to entry PF02768 DNA_pol3_beta_3, DNA FT polymerase III beta subunit, C-terminal domain, score FT 207.80, E-value 1.7e-58" FT /colour=9 FT CDS 3670..3915 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0003" FT /note="Similar to Bacillus subtilis hypothetical protein FT YaaA SW:YAAA_BACSU (P05650) (71 aa) fasta scores: E(): FT 3.8e-07, 48.438% id in 64 aa, and to Bacillus halodurans FT hypothetical protein YyaA TR:Q9RCA0 (EMBL:AB013492) (73 FT aa) fasta scores: E(): 6.4e-07, 46.667% id in 60 aa" FT /product="conserved hypothetical protein" FT CDS 3912..5024 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0004" FT /gene="recF" FT /note="Previously sequenced as Staphylococcus aureus DNA FT replication and repair protein RecF SW:RECF_STAAU (P29232) FT (370 aa) fasta scores: E(): 1.1e-129, 100.000% id in 370 FT aa. Similar to Bacillus subtilis DNA replication and FT repair protein RecF SW:RECF_BACSU (P05651) (370 aa) fasta FT scores: E(): 6.1e-77, 58.649% id in 370 aa" FT /product="DNA replication and repair protein RecF" FT misc_feature 3918..4070 FT /note="Pfam match to entry PF00470 RecF, RecF protein, FT score 42.50, E-value 7.2e-11" FT /colour=9 FT misc_feature 3999..4022 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 4242..4319 FT /colour=8 FT /note="PS00617 RecF protein signature 1." FT misc_feature 4650..5018 FT /note="Pfam match to entry PF00470 RecF, RecF protein, FT score 16.20, E-value 0.0014" FT /colour=9 FT misc_feature 4848..4901 FT /colour=8 FT /note="PS00618 RecF protein signature 2." FT CDS 5037..6968 FT /EC_number="5.99.1.3" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0005" FT /gene="gyrB" FT /gene="novA" FT /note="Previously sequenced as Staphylococcus aureus DNA FT gyrase subunit B GyrB SW:GYRB_STAAU (P20832) (643 aa) FT fasta scores: E(): 0, 99.844% id in 643 aa, Similar to FT Bacillus subtilis DNA gyrase subunit B GyrB SW:GYRB_BACSU FT (P05652) (638 aa) fasta scores: E(): 1.8e-166, 69.194% id FT in 633 aa. Similar to SAR0621, 23.973% identity (26.718% FT ungapped) in 146 aa overlap" FT /product="DNA gyrase subunit B" FT misc_feature 5148..5582 FT /note="Pfam match to entry PF02518 HATPase_c, Histidine FT kinase-, DNA gyrase B-, phytochrome-like ATPase, score FT 86.60, E-value 1.4e-22" FT /colour=9 FT misc_feature 5538..5558 FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site." FT misc_feature 5598..6155 FT /note="Pfam match to entry PF00204 DNA_topoisoII, DNA FT topoisomerase II (N-terminal region), score 349.80, FT E-value 2.9e-101" FT /colour=9 FT misc_feature 6330..6356 FT /colour=8 FT /note="PS00177 DNA topoisomerase II signature." FT misc_feature 6408..6653 FT /note="Pfam match to entry PF01751 Toprim, Toprim domain, FT score 41.60, E-value 1.8e-08" FT /colour=9 FT misc_feature 6735..6935 FT /note="Pfam match to entry PF00986 DNA_gyraseB_C, DNA FT gyrase B subunit, carboxyl terminus, score 151.90, E-value FT 1.1e-41" FT /colour=9 FT CDS 7005..9665 FT /EC_number="5.99.1.3" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0006" FT /gene="gyrA" FT /gene="nalA" FT /gene="cafB" FT /note="Previously sequenced as Staphylococcus aureus DNA FT gyrase subunit A GyrA SW:GYRA_STAAU (P20831) (889 aa) FT fasta scores: E(): 0, 98.875% id in 889 aa, Similar to and FT to Bacillus subtilis DNA gyrase subunit A GyrA FT SW:GYRA_BACSU (P05653) (821 aa) fasta scores: E(): 5e-194, FT 64.485% id in 825 aa" FT /product="DNA gyrase subunit A" FT misc_feature 7101..8447 FT /note="Pfam match to entry PF00521 DNA_topoisoIV, DNA FT gyrase/topoisomerase IV, subunit A, score 1052.50, E-value FT 0" FT /colour=9 FT misc_feature 7665..7688 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(9753..10583) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0007" FT /note="Similar to Lactococcus lactis hypothetical protein FT YcfG TR:Q9CIU7 (EMBL:AE006263) (275 aa) fasta scores: E(): FT 5.6e-41, 47.445% id in 274 aa, and to Streptococcus FT thermophilus hypothetical protein YfoL SW:YFOL_STRTR FT (P96051) (278 aa) fasta scores: E(): 1.8e-40, 46.241% id FT in 266 aa" FT /product="conserved hypothetical protein" FT misc_feature complement(9777..10496) FT /note="Pfam match to entry PF01256 UPF0031, FT Uncharacterized protein family UPF0031, score 235.40, FT E-value 7.9e-67" FT /colour=9 FT misc_feature complement(9915..9947) FT /colour=8 FT /note="PS01050 Uncharacterized protein family UPF0031 FT signature 2." FT misc_feature complement(10263..10295) FT /colour=8 FT /note="PS01049 Uncharacterized protein family UPF0031 FT signature 1." FT CDS 10891..12405 FT /EC_number="4.3.1.3" FT /class="3.4.2" FT /colour=5 FT /locus_tag="SAR0008" FT /gene="hutH" FT /note="Similar to Bacillus subtilis histidine FT ammonia-lyase HutH SW:HUTH_BACSU (P10944) (508 aa) fasta FT scores: E(): 3.6e-118, 62.525% id in 491 aa, and to FT Bacillus halodurans histidine ammonia-lyase HutH FT SW:HUTH_BACHD (Q9KBE6) (511 aa) fasta scores: E(): FT 5.4e-111, 57.948% id in 497 aa" FT /product="putative histidine ammonia-lyase" FT misc_feature 10891..12375 FT /note="Pfam match to entry PF00221 PAL, Phenylalanine and FT histidine ammonia-lyase, score 713.20, E-value 2.5e-221" FT /colour=9 FT misc_feature 11302..11349 FT /colour=8 FT /note="PS00488 Phenylalanine and histidine ammonia-lyases FT signature." FT misc_RNA 12491..12722 FT /note="T-box leader as predicted by Rfam (RF00230), score FT 82.32" FT CDS 12783..14069 FT /EC_number="6.1.1.11" FT /class="2.2.01" FT /colour=2 FT /locus_tag="SAR0009" FT /gene="serS" FT /note="Previously sequenced as Staphylococcus aureus FT seryl-tRNA synthetase SerS SW:SYS_STAAU (P95689) (428 aa) FT fasta scores: E(): 4.5e-163, 99.766% id in 428 aa. Similar FT to Streptococcus pyogenes putative seryl-tRNAsynthetase FT SerS TR:Q99YE2 (EMBL:AE006602) (425 aa) fasta scores: E(): FT 1.2e-92, 58.255% id in 424 aa" FT /product="seryl-tRNA synthetase" FT misc_feature 12783..12926 FT /note="Pfam match to entry PF02403 Seryl_tRNA_N, FT Seryl-tRNA synthetase N-terminal domain, score 79.50, FT E-value 6.7e-20" FT /colour=9 FT misc_feature 12987..14036 FT /note="Pfam match to entry PF00587 tRNA-synt_2b, tRNA FT synthetase class II (G, H, P, S and T), score 310.40, FT E-value 2.1e-89" FT /colour=9 FT misc_feature 13563..13637 FT /colour=8 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1." FT CDS 14713..15408 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0010" FT /note="Similar to Bacillus subtilis probable FT branched-chain amino acid transport protein AzlC FT SW:AZLC_BACSU (O07942) (254 aa) fasta scores: E(): FT 3.5e-12, 28.182% id in 220 aa, and to Lactococcus lactis FT possible amino acid permease YqfD TR:Q9CF68 FT (EMBL:AE006391) (235 aa) fasta scores: E(): 1.6e-31, FT 40.773% id in 233 aa" FT /product="putative membrane protein" FT misc_feature join(14755..14808,14821..14889,14899..14967,15112..15180,15193..15261,15280..15336,15346..15399) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0010 by TMHMM2.0 at aa 15-32, 37-59, 63-85, 134-156, FT 161-183, 190-208 and 212-229" FT CDS 15405..15734 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0011" FT /note="Similar to Lactococcus lactis hypothteical protein FT YqfC TR:Q9CF69 (EMBL:AE006391) (108 aa) fasta scores: E(): FT 2.5e-09, 35.294% id in 102 aa, and to Leishmania major FT hypothetical protein LM12.1384 TR:Q9GVH4 (EMBL:AL390114) FT (109 aa) fasta scores: E(): 0.35, 26.804% id in 97 aa" FT /product="putative membrane protein" FT misc_feature 15405..15506 FT /note="Signal peptide predicted for SAR0011 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.880) with cleavage site FT probability 0.549 between residues 34 and 35" FT /colour=6 FT misc_feature join(15423..15491,15519..15578,15612..15665,15675..15728) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0011 by TMHMM2.0 at aa 7-29, 39-58, 70-87 and 91-108" FT misc_RNA 15939..16037 FT /note="SAM riboswitch (S box leader) as predicted by Rfam FT (RF00162), score 80.12" FT CDS 16096..17064 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0012" FT /note="Similar to Corynebacterium glutamicum homoserine FT O-acetyltransferase MetA SW:METX_CORGL (O68640) (379 aa) FT fasta scores: E(): 1.4e-05, 28.412% id in 359 aa, and to FT Thermus aquaticus homoserine O-acetyltransferase Met2 FT SW:METX_THETH (Q9RA51) (380 aa) fasta scores: E(): FT 2.7e-12, 34.783% id in 345 aa. Possible alternative FT translational start site" FT /product="putative hydrolase" FT misc_feature 16321..17037 FT /note="Pfam match to entry PF00561 abhydrolase, alpha/beta FT hydrolase fold, score 35.80, E-value 1e-06" FT /colour=9 FT CDS 17309..18295 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0013" FT /note="Weak similarity to Bacillus halodurans hypothetical FT protein BH4032 TR:Q9K5Q6 (EMBL:AP001520) (312 aa) fasta FT scores: E(): 9.9e-12, 22.295% id in 305 aa, and to FT Bacillus subtilis hypothetical protein YybS SW:YYBS_BACSU FT (P37485) (309 aa) fasta scores: E(): 5e-10, 22.006% id in FT 309 aa. Possible alternative translational start site" FT /product="putative membrane protein" FT misc_feature join(17423..17491,17534..17629,17666..17734,17870..17938,17975..18043,18071..18139,18176..18244) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0013 by TMHMM2.0 at aa 39-61, 76-107, 120-142, 188-210, FT 223-245, 255-277 and 290-312" FT CDS 18310..20277 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0014" FT /note="Similar to Bacillus subtilis hypothetical protein FT YybT SW:YYBT_BACSU (P37484) (659 aa) fasta scores: E(): FT 1.4e-114, 50.779% id in 642 aa, and to Bacillus halodurans FT hypothetical protein BH4031 TR:Q9K5Q7 (EMBL:AP001520) (654 FT aa) fasta scores: E(): 1.6e-110, 45.912% id in 636 aa" FT /product="putative membrane protein" FT misc_feature 18310..18426 FT /note="Signal peptide predicted for SAR0014 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.958) with cleavage site FT probability 0.498 between residues 39 and 40" FT /colour=6 FT misc_feature join(18334..18402,18412..18471) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0014 by TMHMM2.0 at aa 9-31 and 35-54" FT misc_feature 19300..19809 FT /note="Pfam match to entry PF01368 DHH, DHH family, score FT 89.20, E-value 8.1e-23" FT /colour=9 FT misc_feature 20056..20238 FT /note="Pfam match to entry PF02272 DHHA1, DHHA1 domain, FT score 28.20, E-value 0.00019" FT /colour=9 FT CDS 20274..20720 FT /class="4.2.2" FT /colour=2 FT /locus_tag="SAR0015" FT /gene="rplI" FT /note="Similar to Bacillus subtilis 50S ribosomal protein FT L9 RplI SW:RL9_BACSU (P37437) (149 aa) fasta scores: E(): FT 6.7e-28, 61.486% id in 148 aa, and to Bacillus FT stearothermophilus 50S ribosomal protein L9 RplI FT SW:RL9_BACST (P02417) (149 aa) fasta scores: E(): 7.7e-28, FT 59.459% id in 148 aa" FT /product="50S ribosomal protein L9" FT misc_feature 20274..20717 FT /note="Pfam match to entry PF01281 Ribosomal_L9, Ribosomal FT protein L9, score 210.90, E-value 2e-59" FT /colour=9 FT misc_feature 20310..20393 FT /colour=8 FT /note="PS00651 Ribosomal protein L9 signature." FT CDS 20752..22152 FT /EC_number="3.6.1.-" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0016" FT /gene="dnaC" FT /note="Similar to Salmonella typhimurium replicative DNA FT helicase DnaB SW:DNAB_SALTY (P10338) (471 aa) fasta FT scores: E(): 1.8e-61, 44.812% id in 453 aa. Previously FT sequenced as Staphylococcus aureus helicase DnaC TR:Q9AQH7 FT (EMBL:AB054590) (466 aa) fasta scores: E(): 7.9e-176, FT 99.785% id in 466 aa" FT /product="DnaB-like helicase" FT misc_feature 20854..21897 FT /note="Pfam match to entry PF00772 DnaB, DnaB-like FT helicase, score 563.60, E-value 1.5e-177" FT /colour=9 FT misc_feature 21379..21402 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 21787..21852 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1117 FT (+2.99 SD) at aa 346-367, sequence RTLKALARELECPVIALSQLSR" FT CDS 22430..23713 FT /EC_number="6.3.4.4" FT /class="3.3.11" FT /colour=7 FT /locus_tag="SAR0017" FT /gene="purA" FT /note="Similar to Bacillus subtilis adenylosuccinate FT synthetase PurA SW:PURA_BACSU (P29726) (430 aa) fasta FT scores: E(): 1.6e-108, 64.953% id in 428 aa, and to FT Streptococcus pyogenes putative adenylosuccinate FT synthetase PurA TR:Q9A1P8 (EMBL:AE006485) (430 aa) fasta FT scores: E(): 1.1e-119, 69.555% id in 427 aa" FT /product="putative adenylosuccinate synthetase" FT misc_feature 22433..23695 FT /note="Pfam match to entry PF00709 Adenylsucc_synt, FT Adenylosuccinate synthetase, score 837.80, E-value FT 3.7e-248" FT /colour=9 FT misc_feature 22457..22480 FT /colour=8 FT /note="PS01266 Adenylosuccinate synthetase GTP-binding FT site." FT misc_feature 22820..22855 FT /colour=8 FT /note="PS00513 Adenylosuccinate synthetase active site." FT misc_feature 23153..23185 FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT signature." FT tRNA 24143..24217 FT /note="tRNA Glu anticodon TTC, Cove score 76.88" FT tRNA 24225..24297 FT /note="tRNA Asp anticodon GTC, Cove score 75.02" FT CDS 24897..25604 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0018" FT /gene="yycF" FT /note="Two-component regulatory system-family, response FT regulator protein. Previously sequenced as Staphylococcus FT aureus response regulator YycF TR:Q9XCM7 (EMBL:AF136709) FT (233 aa) fasta scores: E(): 1.5e-91, 100.000% id in 233 FT aa. Similar to Lactococcus lactis probable transcriptional FT regulatory protein ArcA TR:O86269 (EMBL:AJ001103) (233 aa) FT fasta scores: E(): 1.9e-57, 62.555% id in 227 aa. Similar FT to SAR1772, 52.155% identity (52.838% ungapped) in 232 aa FT overlap" FT /product="response regulator protein" FT misc_feature 24909..25265 FT /note="Pfam match to entry PF00072 response_reg, Response FT regulator receiver domain, score 130.70, E-value 2.6e-35" FT /colour=9 FT misc_feature 25362..25580 FT /note="Pfam match to entry PF00486 trans_reg_C, FT Transcriptional regulatory protein, C terminal, score FT 117.90, E-value 5.4e-34" FT /colour=9 FT CDS 25617..27443 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0019" FT /gene="yycG" FT /gene="vicK" FT /note="Two-component regulatory system family, sensor FT kinase protein. Previously sequenced as Staphylococcus FT aureus two-component sensor histidine kinase YycG FT TR:Q9XCM6 (EMBL:AF136709) (608 aa) fasta scores: E(): FT 5.5e-214, 99.836% id in 608 aa. Similar to Bacillus FT subtilis probable two-component sensor histidine kinase FT YycG TR:Q45614 (EMBL:D78193) (611 aa) fasta scores: E(): FT 2e-98, 46.217% id in 608 aa" FT /product="sensor kinase protein" FT misc_feature join(25659..25727,26163..26231) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0019 by TMHMM2.0 at aa 15-37 and 183-205" FT misc_feature 26166..26375 FT /note="Pfam match to entry PF00672 HAMP, HAMP domain, FT score 66.10, E-value 7.3e-16" FT /colour=9 FT misc_feature 26403..26597 FT /note="Pfam match to entry PF00989 PAS, PAS domain, score FT 37.90, E-value 6.9e-09" FT /colour=9 FT misc_feature 26739..26942 FT /note="Pfam match to entry PF00512 signal, His Kinase A FT (phosphoacceptor) domain, score 91.10, E-value 2.3e-23" FT /colour=9 FT misc_feature 27072..27416 FT /note="Pfam match to entry PF02518 HATPase_c, Histidine FT kinase-, DNA gyrase B-, phytochrome-like ATPase, score FT 156.60, E-value 4.2e-43" FT /colour=9 FT CDS 27436..28770 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0020" FT /gene="yycH" FT /note="Similar to Bacillus subtilis hypothetical protein FT YycH TR:Q45613 (EMBL:D78193) (458 aa) fasta scores: E(): FT 2.7e-11, 19.697% id in 462 aa. Previously sequenced as FT Staphylococcus aureus hypothetical protein YycH TR:Q9RDT2 FT (EMBL:AJ012052) (465 aa) fasta scores: E(): 7.4e-166, FT 98.658% id in 447 aa. Possible alternative translational FT start site" FT /product="putative exported protein" FT misc_feature 27436..27543 FT /note="Signal peptide predicted for SAR0020 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.998) with cleavage site FT probability 0.846 between residues 36 and 37" FT /colour=6 FT misc_feature 27454..27522 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0020 by TMHMM2.0 at aa 7-29" FT CDS 28771..29559 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0021" FT /gene="yycI" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH4024 TR:Q9K5R4 (EMBL:AP001520) (262 aa) fasta scores: FT E(): 4.3e-11, 25.735% id in 272 aa. Previously sequenced FT as Staphylococcus aureus hypothetical protein YycI FT TR:Q9RDT1 (EMBL:AJ012052) (262 aa) fasta scores: E(): FT 4.1e-87, 97.710% id in 262 aa." FT /product="putative exported protein" FT misc_feature 28771..28863 FT /note="Signal peptide predicted for SAR0021 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.852) with cleavage site FT probability 0.828 between residues 31 and 32" FT /colour=6 FT misc_feature 28795..28848 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0021 by TMHMM2.0 at aa 9-26" FT CDS 29947..30747 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0022" FT /gene="yycJ" FT /note="Similar to Bacillus subtilis hypothetical protein FT YycJ TR:Q45611 (EMBL:D78193) (268 aa) fasta scores: E(): FT 3e-60, 62.069% id in 261 aa. Previously sequenced as FT Staphylococcus aureus hypothetical protein YycJ TR:Q9RDT0 FT (EMBL:AJ012052) (269 aa) fasta scores: E(): 2.4e-103, FT 99.624% id in 266 aa" FT /product="metallo-beta-lactamase superfamily protein" FT misc_feature 29947..30015 FT /note="Signal peptide predicted for SAR0022 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.600) with cleavage site FT probability 0.235 between residues 23 and 24" FT /colour=6 FT misc_feature 29977..30606 FT /note="Pfam match to entry PF00753 lactamase_B, FT Metallo-beta-lactamase superfamily, score 14.50, E-value FT 0.00016" FT /colour=9 FT CDS 30932..33292 FT /class="4.1.8" FT /colour=3 FT /locus_tag="SAR0023" FT /gene="sasH" FT /note="Internal region is similar to Discopyge ommata FT 5'-nucleotidase precursor protein SW:5NTD_DISOM (P29240) FT (577 aa) fasta scores: E(): 3.9e-19, 28.866% id in 582 aa, FT and to Rhizobium loti possible 5'-nucleotidase MLR3017 FT TR:BAB50004 (EMBL:AP003001) (706 aa) fasta scores: E(): FT 5.7e-22, 28.852% id in 610 aa. Probable LPXTG-sorted FT surface protein" FT /product="putative 5'-nucleotidase" FT misc_feature 30932..31060 FT /note="Signal peptide predicted for SAR0023 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.705) with cleavage site FT probability 0.225 between residues 43 and 44" FT /colour=6 FT misc_feature 30980..31048 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0023 by TMHMM2.0 at aa 17-39" FT misc_feature 31394..32269 FT /note="Pfam match to entry PF01009 5_nucleotidase, FT 5'-nucleotidase, catalytic domain, score 196.10, E-value FT 1.3e-56" FT /colour=9 FT misc_feature 31619..31654 FT /colour=8 FT /note="PS00786 5'-nucleotidase signature 2." FT misc_feature 32276..32848 FT /note="Pfam match to entry PF02872 5_nucleotidaseC, FT 5'-nucleotidase, C-terminal domain, score 261.10, E-value FT 1.5e-74" FT /colour=9 FT misc_feature 33188..33205 FT /colour=8 FT /note="PS00343 Gram-positive cocci surface proteins FT 'anchoring' hexapeptide." FT CDS 33660..34139 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0024" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH4007 TR:Q9K5T1 (EMBL:AP001520) (159 aa) fasta scores: FT E(): 2.3e-32, 63.522% id in 159 aa. Previously sequenced FT as Staphylococcus aureus hypothetical protein TR:BAB47141 FT (EMBL:AB047239) (159 aa) fasta scores: E(): 1.1e-53, FT 100.000% id in 159 aa" FT /product="conserved hypothetical protein" FT misc_feature 33660..34133 FT /note="Pfam match to entry PF02590 DUF163, Uncharacterized FT ACR, COG1576, score 259.60, E-value 4.3e-74" FT /colour=9 FT repeat_unit complement(34121..34137) FT /note="SCC imperfect repeat" FT misc_feature complement(34121..87023) FT /colour=0 FT /note="Staphylococcal cassette chromosome mec (SCCmec)" FT /label=SCCmec FT CDS 34422..35717 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0025" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein TR:Q9KJC5 FT (EMBL:AF181950) (419 aa) fasta scores: E(): 2.6e-140, FT 99.752% id in 403 aa" FT /product="hypothetical protein" FT CDS 36132..36371 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0026" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT repeat_region 36343..36359 FT /note="IS element inverted repeat" FT misc_feature complement(36344..37133) FT /note="Insertion sequence IS431" FT /colour=0 FT /label=IS431 FT CDS complement(36403..37077) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0027" FT /note="Identical to Staphylococcus aureus IS431 putative FT transposase TR:BAB47631 (EMBL:AB037671) (224 aa) fasta FT scores: E(): 1.8e-88, 100.000% id in 224 aa, and similar FT to Staphylococcus epidermidis IS257 transposase Tnp FT TR:BAB39484 (EMBL:AB049452) (224 aa) fasta scores: E(): FT 1.4e-87, 99.107% id in 224 aa" FT /product="putative transposase" FT misc_feature complement(36421..36885) FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 66.80, E-value 3.9e-18" FT /colour=9 FT misc_feature complement(36922..36987) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 980 FT (+2.52 SD) at aa 31-52, sequence ISEILRERGVNVHHSTVYRWVQ" FT repeat_region complement(37118..37133) FT /note="IS element inverted repeat" FT CDS complement(join(37168..37377,37381..38172)) FT /class="5.1.3" FT /colour=11 FT /locus_tag="SAR0028" FT /gene="repB" FT /note="Similar to several proteins involved in Gram FT positive plasmid replication. Similar to Staphylococcus FT cohnii and unidentified sp plasmid replication protein FT RepB TR:Q51988 (EMBL:U32369) (334 aa) fasta scores: E(): FT 2e-127, 99.701% id in 334 aa. C-terminal region is similar FT to Staphylococcus aureus, and Bacillus sp plasmid FT replication protein RepB SW:REPB_STAAU (P05061) (235 aa) FT fasta scores: E(): 3.2e-86, 99.574% id in 235 aa. Possible FT alternative translational start sites. Contains a nonsense FT mutation (ochre) after codon 264" FT /product="replication protein (pseudogene)" FT /pseudo FT misc_feature complement(37177..37374) FT /note="Pfam match to entry PF01446 Rep, Replication FT protein, score 126.50, E-value 5.8e-35" FT /colour=9 FT misc_feature complement(37381..37875) FT /note="Pfam match to entry PF01446 Rep, Replication FT protein, score 346.80, E-value 2.4e-100" FT /colour=9 FT CDS complement(38197..38373) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0030" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS complement(38396..39658) FT /class="5.1.3" FT /colour=2 FT /locus_tag="SAR0031" FT /gene="pre" FT /gene="mob" FT /note="Identical to Staphylococcus aureus plasmid (pUB110) FT recombination enzyme Pre SW:PRE2_STAAU (P22490) (420 aa) FT fasta scores: E(): 3e-135, 100.000% id in 420 aa, and FT highly similar to Staphylococcus cohnii plasmid (pIP1714) FT recombination/mobilization protein Pre TR:O87277 FT (EMBL:AF015628) (420 aa) fasta scores: E(): 1.1e-134, FT 99.762% id in 420 aa. Contains coiled-coiled domain, FT residues 189 to 213" FT /product="plasmid recombination enzyme" FT misc_feature complement(39080..39658) FT /note="Pfam match to entry PF01076 Mob_Pre, Plasmid FT recombination enzyme, score 364.10, E-value 1.4e-105" FT /colour=9 FT CDS 39767..39907 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0031a" FT /note="Doubtful CDS. No significant database hits" FT /product="hypothetical protein" FT CDS 39973..40146 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0031b" FT /note="Doubtful CDS. No significant database hits" FT /product="hypothetical protein" FT CDS complement(40165..40569) FT /class="1.4.3" FT /colour=0 FT /locus_tag="SAR0032" FT /gene="ble" FT /note="Previously sequenced as Staphylococcus aureus FT bleomycin resistance protein Ble TR:BAA82230 (EMBL:D86934) FT (134 aa) fasta scores: E(): 3.6e-57, 99.254% id in 134 aa. FT Similar to Bacillus subtilis hypothetical protein YraH FT TR:O07918 (EMBL:X92868) (128 aa) fasta scores: E(): FT 0.0082, 26.357% id in 129 aa" FT /product="bleomycin resistance protein" FT misc_feature complement(40168..40539) FT /note="Pfam match to entry PF00903 Glyoxalase, FT Glyoxalase/Bleomycin resistance protein/Dioxygenase FT superfamily, score 72.90, E-value 8.5e-20" FT /colour=9 FT CDS complement(40786..41556) FT /EC_number="2.7.7.-" FT /class="1.4.3" FT /colour=0 FT /locus_tag="SAR0033" FT /gene="knt" FT /gene="kan" FT /note="Highly similar to Staphylococcus aureus plasmid FT (pUB110) kanamycin nucleotidyltransferase Knt FT SW:KANU_STAAU (P05057) (253 aa) fasta scores: E(): FT 2.4e-104, 99.605% id in 253 aa, and to Bacillus sp plasmid FT (pRBH1 and pTB913) kanamycin nucleotidyltransferase Knt FT SW:KANU_BACSP (P05058) (253 aa) fasta scores: E(): FT 5.9e-104, 99.209% id in 253 aa" FT /product="kanamycin nucleotidyltransferase" FT misc_feature complement(40789..41547) FT /note="Pfam match to entry PF02314 KNTase, Kanamycin FT nucleotidyltransferase, score 818.70, E-value 2.1e-242" FT /colour=9 FT repeat_region 41689..41705 FT /note="IS element inverted repeat" FT misc_feature complement(41690..42479) FT /note="Insertion sequence IS431" FT /colour=0 FT /label=IS431 FT CDS complement(41749..42423) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0034" FT /note="Identical to Staphylococcus aureus IS431 putative FT transposase TR:BAB47631 (EMBL:AB037671) (224 aa) fasta FT scores: E(): 1.8e-88, 100.000% id in 224 aa, and similar FT to Staphylococcus epidermidis IS257 transposase Tnp FT TR:BAB39484 (EMBL:AB049452) (224 aa) fasta scores: E(): FT 1.4e-87, 99.107% id in 224 aa" FT /product="putative transposase" FT misc_feature complement(41767..42231) FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 66.80, E-value 3.9e-18" FT /colour=9 FT misc_feature complement(42268..42333) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 980 FT (+2.52 SD) at aa 31-52, sequence ISEILRERGVNVHHSTVYRWVQ" FT repeat_region complement(42464..42480) FT /note="IS element inverted repeat" FT CDS 42681..42848 FT /class="3.3.14" FT /colour=11 FT /locus_tag="SAR0035" FT /note="Similar to the C-terminal region of Staphylococcus FT aureus HMG-CoA synthase MvaS TR:Q9FD87 (EMBL:AF290086) FT (388 aa) fasta scores: E(): 8.7e-05, 43.137% id in 51 aa. FT Previously sequenced as Staphylococcus aureus hypothetical FT protein TR:BAB47630 (EMBL:AB037671) (55 aa) fasta scores: FT E(): 2e-21, 100.000% id in 55 aa. Similarity with the FT HMG-CoA synthase MvaS extends beyond the translational FT start to the upstream IS element. Probable gene remnant" FT /partial FT /product="HMG-CoA synthase (partial)" FT CDS 42946..43155 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0036" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein TR:Q9XB76 FT (EMBL:D86934) (76 aa) fasta scores: E(): 2.7e-26, 100.000% FT id in 69 aa. CDS is 7 amino acids shorter at the FT C-terminus" FT /product="putative membrane protein" FT misc_feature 43060..43119 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0036 by TMHMM2.0 at aa 39-58" FT misc_feature 43104..43431 FT /note="Imperfect repeat, FT gataagaggtaagttaaaagcagttctaagtaaaattgca x8" FT CDS 43605..44348 FT /EC_number="3.1.4.46" FT /class="2.2.07" FT /colour=5 FT /locus_tag="SAR0037" FT /gene="ugpQ" FT /note="Similar to Escherichia coli glycerophosphoryl FT diester phosphodiesterase UgpQ SW:UGPQ_ECOLI (P10908) (247 FT aa) fasta scores: E(): 1.6e-22, 35.443% id in 237 aa. FT Previously sequenced as Staphylococcus aureus FT glycerophosphoryldiester phosphodiesterase UgpQ TR:Q9S3K5 FT (EMBL:D86934) (247 aa) fasta scores: E(): 2e-93, 100.000% FT id in 247 aa" FT /product="glycerophosphoryl diester phosphodiesterase" FT CDS 44445..44873 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0038" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein TR:BAB47625 (EMBL:AB037671) (142 aa) FT fasta scores: E(): 2e-52, 100.000% id in 142 aa. Similar FT to Bacillus subtilis YdeM protein ydeM TR:P96670 FT (EMBL:AB001488) (141 aa) fasta scores: E(): 1.5e-30, FT 56.115% id in 139 aa" FT /product="conserved hypothetical protein" FT misc_feature 44457..44816 FT /note="Pfam match to entry PF01575 MaoC_dehydratas, MaoC FT like domain, score 146.00, E-value 6.8e-40" FT /colour=9 FT CDS complement(44919..46925) FT /class="4.1.9" FT /colour=3 FT /locus_tag="SAR0039" FT /gene="mecA" FT /note="Identical to Staphylococcus epidermidis, and FT Staphylococcus aureus penicillin-binding protein 2 prime FT MecA TR:Q54113 (EMBL:X52592) (668 aa) fasta scores: E(): FT 0, 100.000% id in 668 aa, and to Staphylococcus sciuri FT methicillin resistanc protein MecA2 TR:O54283 FT (EMBL:Y13095) (668 aa) fasta scores: E(): 0, 99.102% id in FT 668 aa" FT /product="penicillin-binding protein 2 prime" FT misc_feature complement(44961..45938) FT /note="Pfam match to entry PF00905 Transpeptidase, FT Penicillin binding protein transpeptidase domain, score FT 380.90, E-value 1.3e-110" FT /colour=9 FT misc_feature complement(46854..46907) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0039 by TMHMM2.0 at aa 7-24" FT misc_feature complement(46854..46925) FT /note="Signal peptide predicted for SAR0039 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.965) with cleavage site FT probability 0.754 between residues 24 and 25" FT /colour=6 FT CDS 47025..48782 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0040" FT /gene="mecR1" FT /gene="mecR" FT /note="Highly similar to Staphylococcus epidermidis, and FT Staphylococcus aureus methicillin resistance protein MecR1 FT SW:MECR_STAEP (P26597) (585 aa) fasta scores: E(): 0, FT 99.829% id in 585 aa, and to Staphylococcus sciuri FT methicillin resistance protein MecR1 TR:CAA73546 FT (EMBL:Y13096) (585 aa) fasta scores: E(): 0, 99.829% id in FT 585 aa" FT /product="methicillin resistance protein MecR1" FT misc_feature join(47037..47105,47142..47210,47331..47399,47970..48038) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0040 by TMHMM2.0 at aa 5-27, 40-62, 103-125 and FT 316-338" FT CDS 48782..49126 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0041" FT /gene="mecI" FT /note="Previously sequenced as Staphylococcus epidermidis, FT and Staphylococcus aureus methicillin resistance FT regulatory protein MecI SW:MECI_STAEP (P26598) (123 aa) FT fasta scores: E(): 2.5e-41, 100.000% id in 114 aa. Similar FT to and to Staphylococcus haemolyticus beta-lactamase FT repressor BlaI TR:Q9K4N1 (EMBL:AJ400722) (126 aa) fasta FT scores: E(): 9e-20, 59.649% id in 114 aa. Similar to FT SAR1829, 59.649% identity (59.649% ungapped) in 114 aa FT overlap" FT /product="methicillin resistance regulatory protein MecI" FT CDS 49263..49466 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0042" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein TR:BAB47620 FT (EMBL:AB037671) (70 aa) fasta scores: E(): 6.3e-26, FT 100.000% id in 67 aa" FT /product="hypothetical protein" FT CDS join(49626..49637,49637..50770) FT /class="6.1.1" FT /colour=11 FT /locus_tag="SAR0043" FT /gene="xylR" FT /note="Similar to Staphylococcus xylosus xylose repressor FT XylR SW:XYLR_STAXY (P27159) (383 aa) fasta scores: E(): FT 2.5e-86, 63.708% id in 383 aa, and to Staphylococcus FT aureus xylose repressor XylR TR:BAB47619 (EMBL:AB037671) FT (382 aa) fasta scores: E(): 1.1e-132, 99.215% id in 382 FT aa. CDS contains a possible frameshift after codon 4. FT Possible alternative translational start sites downstream FT of this, therefore the effect on the function of this CDS FT is not known" FT /product="xylose repressor (pseudogene)" FT /pseudo FT misc_feature 49691..49756 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1609 FT (+4.67 SD) at aa 11-32, sequence ISRTQISKNLEINKATISSILN" FT misc_feature 49868..50341 FT /note="Pfam match to entry PF00480 ROK, ROK family, score FT 170.40, E-value 1.3e-49" FT /colour=9 FT misc_feature 50249..50332 FT /colour=8 FT /note="PS01125 ROK family signature." FT CDS complement(join(50884..51279,51283..52218)) FT /class="7.0.0" FT /colour=11 FT /locus_tag="SAR0044" FT /note="Similar to Staphylococcus aureus hypothetical FT protein TR:Q9S0L8 (EMBL:AB033763) (442 aa) fasta scores: FT E(): 4.4e-132, 70.159% id in 439 aa, and to Deinococcus FT radiodurans conserved hypothetical protein DRA0304 FT TR:Q9RYK8 (EMBL:AE001863) (483 aa) fasta scores: E(): FT 4.6e-45, 37.773% id in 458 aa. Contains a nonsense FT mutation (ochre) after codon 312" FT /product="metallo-beta-lactamase superfamily protein FT (pseudogene)" FT /pseudo FT misc_feature complement(50893..51168) FT /note="Pfam match to entry PF00581 Rhodanese, FT Rhodanese-like domain, score 28.50, E-value 0.00015" FT /colour=9 FT misc_feature complement(51634..52197) FT /note="Pfam match to entry PF00753 lactamase_B, FT Metallo-beta-lactamase superfamily, score 79.30, E-value FT 8.2e-20" FT /colour=9 FT CDS complement(52251..53315) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0046" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein TR:BAB47615 (EMBL:AB037671) (354 aa) FT fasta scores: E(): 3.9e-133, 100.000% id in 354 aa. FT C-terminus is similar to Bacillus subtilis hypothetical FT protein YrkE SW:YRKE_BACSU (P54432) (160 aa) fasta scores: FT E(): 7.3e-25, 52.941% id in 153 aa" FT /product="hypothetical protein" FT misc_feature complement(52755..52970) FT /note="Pfam match to entry PF01206 UPF0033, FT Uncharacterized protein family UPF0033, score 34.00, FT E-value 3.5e-06" FT /colour=9 FT misc_feature complement(53019..53273) FT /note="Pfam match to entry PF00581 Rhodanese, FT Rhodanese-like domain, score 40.50, E-value 3.8e-08" FT /colour=9 FT CDS 53445..53711 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0047" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein TR:BAB47614 (EMBL:AB037671) (88 aa) FT fasta scores: E(): 2.8e-29, 100.000% id in 88 aa. Similar FT to Lactococcus lactis hypothetical protein YhjE TR:Q9CHE5 FT (EMBL:AE006312) (84 aa) fasta scores: E(): 3.2e-09, FT 42.683% id in 82 aa" FT /product="conserved hypothetical protein" FT misc_feature 53520..53705 FT /note="Pfam match to entry PF02583 DUF156, Uncharacterized FT BCR, COG1937, score 60.00, E-value 5e-14" FT /colour=9 FT CDS 53711..54355 FT /class="4.1.6" FT /colour=11 FT /locus_tag="SAR0048" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein TR:BAB47613 (EMBL:AB037671) (214 aa) FT fasta scores: E(): 1.2e-68, 100.000% id in 214 aa. Similar FT to Bacillus subtilis hypothetical protein YrkJ FT SW:YRKJ_BACSU (P54437) (261 aa) fasta scores: E(): FT 4.4e-26, 41.364% id in 220 aa. CDS is truncated at the FT C-terminus in comparison to the B. subtilis protein. FT Probable gene remnant" FT /product="putative membrane protein (partial)" FT /partial FT misc_feature 53711..53854 FT /note="Signal peptide predicted for SAR0048 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.858) with cleavage site FT probability 0.548 between residues 48 and 49" FT /colour=6 FT misc_feature join(53738..53806,53810..53878,53951..54019,54032..54085,54128..54223,54242..54298) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0048 by TMHMM2.0 at aa 10-32, 34-56, 81-103, 108-125, FT 140-171 and 178-196" FT misc_feature 53993..54316 FT /note="Pfam match to entry PF01925 DUF81, Domain of FT unknown function DUF81, score 55.30, E-value 1.2e-14" FT /colour=9 FT misc_feature complement(54464..61171) FT /note="Transposon Tn554" FT /colour=0 FT /label=Tn554 FT CDS complement(54694..55356) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0049" FT /note="Highly similar to Staphylococcus aureus transposon FT Tn554 hypothetical protein TR:Q48363 (EMBL:X03216) (220 FT aa) fasta scores: E(): 2.8e-82, 99.545% id in 220 aa, and FT to Lactococcus lactis hypothetical protein YljG TR:Q9CGB7 FT (EMBL:AE006350) (206 aa) fasta scores: E(): 3.2e-06, FT 25.837% id in 209 aa" FT /product="hypothetical protein" FT CDS 55890..56621 FT /EC_number="2.1.1.48" FT /class="1.4.3" FT /colour=12 FT /locus_tag="SAR0050" FT /gene="ermA1" FT /note="Previously sequenced as Staphylococcus aureus FT macrolide-lincosamide-streptogramin B resistance protein, FT rRNA adenine N-6-methyltransferase ErmA SW:ERM1_STAAU FT (P06699) (243 aa) fasta scores: E(): 1.7e-90, 100.000% id FT in 243 aa. Similar to Streptococcus pyogenes erythromycin FT resistance methylase ErmTR TR:O07480 (EMBL:AF002716) (243 FT aa) fasta scores: E(): 7.2e-74, 81.070% id in 243 aa" FT /product="rRNA adenine N-6-methyltransferase 1" FT misc_feature 55917..56600 FT /note="Pfam match to entry PF00398 RrnaAD, Ribosomal RNA FT adenine dimethylases, score 425.90, E-value 9.3e-132" FT /colour=9 FT misc_feature 55989..56072 FT /colour=8 FT /note="PS01131 Ribosomal RNA adenine dimethylases FT signature." FT CDS complement(56747..57529) FT /EC_number="2.7.7.47" FT /class="1.4.3" FT /colour=12 FT /locus_tag="SAR0051" FT /gene="spc1" FT /note="Previously sequenced as Staphylococcus aureus FT streptomycin and spectomycin resistance protein, FT streptomycin 3''-adenylyltransferase Spc SW:S3AD_STAAU FT (P04827) (260 aa) fasta scores: E(): 4e-100, 100.000% id FT in 260 aa. Similar to Streptomyces coelicolor putative FT nucleotidyltransferase SCD19.10 TR:Q9F2Z2 (EMBL:AL392149) FT (257 aa) fasta scores: E(): 4.6e-34, 44.493% id in 227 aa" FT /product="streptomycin 3''-adenylyltransferase 1" FT misc_feature complement(57191..57505) FT /note="Pfam match to entry PF01909 NTP_transf_2, FT Nucleotidyltransferase domain, score 82.10, E-value FT 1.2e-20" FT /colour=9 FT CDS complement(57680..58057) FT /class="7.0.0" FT /colour=12 FT /locus_tag="SAR0052" FT /gene="tnpC1" FT /note="Previously sequenced as Staphylococcus aureus FT transposase C TnpC TR:BAB47665 (EMBL:AB037671) (125 aa) FT fasta scores: E(): 1.1e-36, 100.000% id in 125 aa. Similar FT to Clostridium butyricum similar hypothetical protein FT TR:Q45924 (EMBL:Z29084) (124 aa) fasta scores: E(): FT 2.1e-09, 41.818% id in 110 aa" FT /product="transposase C 1" FT misc_feature complement(57875..57940) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1150 FT (+3.10 SD) at aa 40-61, sequence INFNSIAKEANVSKSWLYKEHD" FT CDS complement(58064..59956) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0053" FT /gene="tnpB1" FT /note="Previously sequenced as Staphylococcus aureus FT transposon Tn554 transposase B TnpB SW:TNPB_STAAU (P06697) FT (630 aa) fasta scores: E(): 0, 100.000% id in 630 aa. FT Similar to Clostridium butyricum hypothetical protein FT TR:Q45923 (EMBL:Z29084) (660 aa) fasta scores: E(): FT 1.7e-14, 24.734% id in 659 aa" FT /product="transposase B 1" FT misc_feature complement(58337..58375) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain." FT misc_feature complement(58427..58966) FT /note="Pfam match to entry PF00589 Phage_integrase, Phage FT integrase family, score 152.60, E-value 7e-42" FT /colour=9 FT misc_feature complement(59039..59299) FT /note="Pfam match to entry PF02899 Phage_integr_N, Phage FT integrase, N-terminal SAM-like domain, score 3.10, E-value FT 0.29" FT /colour=9 FT CDS complement(59953..61038) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0054" FT /gene="tnpA1" FT /note="Previously sequenced as Staphylococcus aureus FT transposon Tn554 transposase A TnpA SW:TNPA_STAAU (P06696) FT (361 aa) fasta scores: E(): 6.8e-137, 99.723% id in 361 FT aa. Similar to Clostridium butyricum hypothetical protein FT TR:Q45922 (EMBL:Z29084) (364 aa) fasta scores: E(): FT 2.6e-28, 37.752% id in 347 aa" FT /product="transposase A 1" FT misc_feature complement(59995..60561) FT /note="Pfam match to entry PF00589 Phage_integrase, Phage FT integrase family, score 196.40, E-value 4.4e-55" FT /colour=9 FT misc_feature complement(60667..60960) FT /note="Pfam match to entry PF02899 Phage_integr_N, Phage FT integrase, N-terminal SAM-like domain, score 25.40, FT E-value 0.0014" FT /colour=9 FT CDS complement(61157..61474) FT /class="7.0.0" FT /colour=11 FT /locus_tag="SAR0055" FT /note="Similar to an internal region of Bacillus subtilis FT probable DNA repair protein RadC SW:RADC_BACSU (Q02170) FT (231 aa) fasta scores: E(): 5e-09, 41.558% id in 77 aa. FT Previously sequenced as Staphylococcus aureus truncated FT DNA repair protein RadC homologue Orf N044 TR:Q9XB90 FT (EMBL:D86934) (105 aa) fasta scores: E(): 2.8e-40, FT 100.000% id in 105 aa. Possible gene remnant" FT /partial FT /product="DNA repair protein RadC (partial)" FT misc_feature complement(61178..61195) FT /colour=8 FT /note="PS01302 DNA repair protein radC family signature." FT CDS complement(61495..62001) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0056" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein Orf N043 TR:Q9KX75 (EMBL:D86934) (168 FT aa) fasta scores: E(): 2.5e-62, 100.000% id in 168 aa. FT Similar to Escherichia coli O157:H7 hypothetical protein FT ECS5248 TR:BAB38671 (EMBL:AP002569) (155 aa) fasta scores: FT E(): 7e-07, 31.333% id in 150 aa" FT /product="conserved hypothetical protein" FT CDS complement(62019..62330) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0057" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein Orf N042 TR:Q9KX76 (EMBL:D86934) (103 FT aa) fasta scores: E(): 3.4e-41, 100.000% id in 103 aa" FT /product="hypothetical protein" FT CDS complement(62417..62767) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0058" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein Orf N041 TR:Q9KX77 (EMBL:D86934) (116 FT aa) fasta scores: E(): 2.5e-47, 100.000% id in 116 aa" FT /product="hypothetical protein" FT CDS complement(63285..64913) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0059" FT /gene="ccrB" FT /note="Similar to Staphylococcus aureus site-specific FT recombinase CcrB TR:Q9XB94 (EMBL:D86934) (542 aa) fasta FT scores: E(): 5.6e-194, 99.815% id in 542 aa, and to FT lactococcal bacteriophage TP901-1 integrase Int TR:Q38184 FT (EMBL:X85213) (485 aa) fasta scores: E(): 2.6e-24, 28.880% FT id in 509 aa" FT /product="site-specific recombinase" FT misc_feature complement(64488..64895) FT /note="Pfam match to entry PF00239 resolvase, Resolvase FT class of site-specific recombinases, score 114.80, E-value FT 2.2e-33" FT /colour=9 FT misc_feature complement(64854..64880) FT /colour=8 FT /note="PS00397 Site-specific recombinases active site." FT CDS complement(64935..66284) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0060" FT /gene="ccrA" FT /note="Similar to Staphylococcus aureus, and site-specific FT recombinase CcrA TR:Q9XB96 (EMBL:D86934) (449 aa) fasta FT scores: E(): 4.4e-165, 95.323% id in 449 aa, and to FT Enterococcus faecalis bacteriophage phi-FC1 site-specific FT integrase TR:Q9XJF6 (EMBL:AF124258) (464 aa) fasta scores: FT E(): 8.9e-18, 26.154% id in 455 aa" FT /product="site-specific recombinase" FT misc_feature complement(65841..66281) FT /note="Pfam match to entry PF00239 resolvase, Resolvase FT class of site-specific recombinases, score 43.30, E-value FT 6.2e-12" FT /colour=9 FT CDS complement(66518..68311) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0061" FT /note="Similar to Staphylococcus aureus hypothetical FT protein Orf N031TR:Q9KX82 (EMBL:D86934) (597 aa) fasta FT scores: E(): 0, 97.822% id in 597 aa. N-terminus is FT similar to SAR0075, 60.068% identity (60.690% ungapped) in FT 293 aa overlap and C-terminus is similar to SAR0074, FT 50.530% identity (51.254% ungapped) in 283 aa overlap" FT /product="putative membrane protein" FT misc_feature complement(67655..67678) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(68311..68607) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0062" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein Orf N030 TR:Q9KX83 (EMBL:D86934) (98 FT aa) fasta scores: E(): 3e-41, 100.000% id in 98 aa" FT /product="hypothetical protein" FT CDS complement(68800..69846) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0063" FT /note="Poor database matches. Similar to an internal FT region of Plasmodium falciparum exported serine/threonine FT protein kinase FesT TR:Q94658 (EMBL:U40232) (2510 aa) FT fasta scores: E(): 0.021, 23.416% id in 363 aa. Previously FT sequenced as Staphylococcus aureus hypothetical protein FT Orf N029 TR:Q9KX84 (EMBL:D86934) (348 aa) fasta scores: FT E(): 2.5e-118, 100.000% id in 348 aa" FT /product="hypothetical protein" FT misc_feature complement(69466..69489) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(join(70097..70585,70589..70939)) FT /class="5.1.4" FT /colour=11 FT /locus_tag="SAR0064" FT /note="Similar to Bacillus anthracis plasmid putative FT IS150-like transposase TR:Q57057 (EMBL:U30715) (274 aa) FT fasta scores: E(): 2.9e-43, 48.905% id in 274 aa, and to FT Bacillus thuringiensis putative transposase TR:P94597 FT (EMBL:Y09946) (301 aa) fasta scores: E(): 1.8e-26, 38.028% FT id in 284 aa. Contains a nonsense mutation (ochre) after FT codon 117" FT /product="putative transposase (pseudogene)" FT /pseudo FT misc_feature complement(70109..70474) FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 76.80, E-value 5.1e-21" FT /colour=9 FT misc_feature complement(70826..70891) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1379 FT (+3.88 SD) at aa 17-38, sequence YSIKLILEVLNIPKSTYYRWKN" FT CDS complement(70924..71238) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0066" FT /note="Similar to Bacillus anthracis similar IS1627s1 FT element OrfA TR:Q57266 (EMBL:U30714) (106 aa) fasta FT scores: E(): 3.2e-18, 51.456% id in 103 aa, and to FT Marinococcus halophilus putative transposase TR:O06062 FT (EMBL:U66614) (110 aa) fasta scores: E(): 9.3e-13, 42.000% FT id in 100 aa" FT /product="putative transposase" FT CDS complement(71749..72651) FT /class="4.1.6" FT /colour=11 FT /locus_tag="SAR0067" FT /note="Similar to the C-terminal regions of Haemophilus FT influenzae hypothetical protein Hi0594 SW:YFCC_HAEIN FT (P44023) (509 aa) fasta scores: E(): 5.7e-62, 58.140% id FT in 301 aa, and to Borrelia burgdorferi conserved FT hypothetical integral membrane protein BB0843 TR:O51783 FT (EMBL:AE001183) (482 aa) fasta scores: E(): 8.2e-31, FT 37.785% id in 307 aa. C-terminal region is identical to FT Staphylococcus aureus hypothetical protein Orf N024 FT TR:Q9KX85 (EMBL:D86934) (185 aa) fasta scores: E(): FT 1.4e-62, 100.000% id in 185 aa. Similar to the C-terminal FT regions of SAR1144, 94.333% identity (94.333% ungapped) in FT 300 aa overlap. Probable gene remnant" FT /partial FT /product="putative membrane protein (partial)" FT misc_feature complement(join(71758..71826,71839..71907,71935..72003,72022..72090,72148..72216,72235..72303,72313..72381,72505..72573)) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0067 by TMHMM2.0 at aa 27-49, 91-113, 117-139, 146-168, FT 188-210, 217-239, 249-271 and 276-298" FT CDS complement(73397..74092) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0068" FT /gene="kdpE" FT /note="Two-component regulatory system family, response FT regulator protein. Similar to Escherichia coli kdp operon FT transcriptional regulatory protein KdpE SW:KDPE_ECOLI FT (P21866) (225 aa) fasta scores: E(): 2.7e-28, 41.593% id FT in 226 aa. Previously sequenced as Staphylococcus aureus FT kdp operon transcriptional regulatory protein KdpE FT TR:Q9XBA2 (EMBL:D86934) (231 aa) fasta scores: E(): FT 5.5e-88, 100.000% id in 231 aa. Similar to SAR2167, FT 61.233% identity (61.778% ungapped) in 227 aa overlap" FT /product="response regulator protein" FT misc_feature complement(73421..73648) FT /note="Pfam match to entry PF00486 trans_reg_C, FT Transcriptional regulatory protein, C terminal, score FT 45.20, E-value 3.8e-12" FT /colour=9 FT misc_feature complement(73730..74086) FT /note="Pfam match to entry PF00072 response_reg, Response FT regulator receiver domain, score 124.50, E-value 2e-33" FT /colour=9 FT CDS complement(74067..76787) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0069" FT /note="Two-component regulatory system family, sensor FT kinase protein. Similar to Clostridium acetobutylicum FT histidine kinase sensor protein KdpD SW:KDPD_CLOAB FT (P94608) (900 aa) fasta scores: E(): 1.2e-75, 29.538% id FT in 887 aa, and to Rhizobium loti two-component sensor KdpD FT TR:BAB50088 (EMBL:AP003001) (907 aa) fasta scores: E(): FT 3.5e-70, 28.699% id in 899 aa. Similar to SAR2166, 58.142% FT identity (58.613% ungapped) in 872 aa overlap" FT /product="sensor kinase protein" FT misc_feature complement(74115..74453) FT /note="Pfam match to entry PF02518 HATPase_c, Histidine FT kinase-, DNA gyrase B-, phytochrome-like ATPase, score FT 112.30, E-value 9e-30" FT /colour=9 FT misc_feature complement(74583..74789) FT /note="Pfam match to entry PF00512 signal, His Kinase A FT (phosphoacceptor) domain, score 67.70, E-value 2.5e-16" FT /colour=9 FT misc_feature complement(join(75303..75362,75396..75449,75459..75512,75531..75584)) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0069 by TMHMM2.0 at aa 402-419, 426-443, 447-464 and FT 476-495" FT misc_feature complement(75663..76772) FT /note="Pfam match to entry PF02702 KdpD, Osmosensitive K+ FT channel His kinase sensor domain, score 244.30, E-value FT 1.7e-69" FT /colour=9 FT CDS 77004..78680 FT /EC_number="3.6.3.12" FT /class="1.5.2" FT /colour=3 FT /locus_tag="SAR0070" FT /note="Similar to Clostridium acetobutylicum FT potassium-transporting ATPase A chain protein KdpA FT SW:ATKA_CLOAB (O32327) (556 aa) fasta scores: E(): FT 5.7e-97, 48.387% id in 558 aa. Previously sequenced as FT Staphylococcus aureus potassium-transporting ATPase FT TR:BAB43902 (EMBL:D86934) (558 aa) fasta scores: E(): FT 1.7e-206, 100.000% id in 558 aa. Similar to SAR2165, FT 67.325% identity (67.446% ungapped) in 557 aa overlap" FT /product="potassium-transporting ATPase A chain" FT misc_feature 77004..77084 FT /note="Signal peptide predicted for SAR0070 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.652) with cleavage site FT probability 0.225 between residues 27 and 28" FT /colour=6 FT misc_feature join(77013..77081,77190..77258,77382..77450,77508..77561,77745..77813,77847..77915,77973..78041,78060..78119,78147..78215,78252..78320,78456..78524,78561..78629) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0070 by TMHMM2.0 at aa 4-26, 63-85, 127-149, 169-186, FT 248-270, 282-304, 324-346, 353-372, 382-404, 417-439, FT 485-507 and 520-542" FT CDS 78699..80720 FT /EC_number="3.6.3.12" FT /class="1.5.2" FT /colour=3 FT /locus_tag="SAR0071" FT /note="Similar to Clostridium acetobutylicum FT potassium-transporting ATPase B chain KdpB SW:ATKB_CLOAB FT (O32328) (685 aa) fasta scores: E(): 1.3e-144, 60.773% id FT in 673 aa. Previously sequenced as Staphylococcus aureus FT potassium-transporting ATPase B chain KdpB SW:ATKB_STAAU FT (Q9XBA9) (673 aa) fasta scores: E(): 0, 100.000% id in 673 FT aa. Similar to SAR2164, 71.556% identity (71.768% FT ungapped) in 675 aa overlap" FT /product="potassium-transporting ATPase B chain" FT misc_feature join(78780..78848,78876..78944,79347..79415,79443..79511,80409..80477,80520..80579,80640..80708) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0071 by TMHMM2.0 at aa 28-50, 60-82, 217-239, 249-271, FT 571-593, 608-627 and 648-670" FT misc_feature 78909..79580 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPase, score 189.80, E-value 1.4e-56" FT /colour=9 FT misc_feature 79590..80294 FT /note="Pfam match to entry PF00702 Hydrolase, haloacid FT dehalogenase-like hydrolase, score 105.90, E-value FT 7.6e-28" FT /colour=9 FT misc_feature 79608..79628 FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site." FT CDS join(80736..81095,81095..81292) FT /class="1.5.2" FT /colour=11 FT /locus_tag="SAR0072" FT /note="Similar to Clostridium acetobutylicum FT potassium-transporting ATPase C chain KdpC SW:ATKC_CLOAB FT (P94606) (204 aa) fasta scores: E(): 9.4e-17, 37.245% id FT in 196 aa. Previously sequenced as Staphylococcus aureus FT potassium-transporting ATPase C chain KdpC SW:ATKC_STAAU FT (Q9LC48) (185 aa) fasta scores: E(): 6.2e-62, 97.297% id FT in 185 aa. Contains a frameshift after codon 120" FT /product="potassium-transporting ATPase C chain FT (pseudogene)" FT /pseudo FT misc_feature 80736..80825 FT /note="Signal peptide predicted for SAR0072 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.394 between residues 30 and 31" FT /colour=6 FT misc_feature 80736..81095 FT /note="Pfam match to entry PF02669 KdpC, K+-transporting FT ATPase, c chain, score 20.90, E-value 3.7e-08" FT /colour=9 FT misc_feature 80754..80822 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0072 by TMHMM2.0 at aa 7-29" FT CDS complement(81837..82706) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0074" FT /note="Poor database matches. Similar to the C-terminal FT region of Staphylococcus aureus hypothetical protein Orf FT N031 TR:Q9KX82 (EMBL:D86934) (597 aa) fasta scores: E(): FT 4.4e-48, 49.823% id in 283 aa. Similar to C-terminal FT region of SAR0061, 50.530% identity (51.254% ungapped) in FT 283 aa overlap. Possible C-terminal region of a nonsense FT mutated protein" FT /product="hypothetical protein" FT misc_feature complement(82011..82034) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(82716..83612) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0075" FT /note="Poor database matches. Similar to the N-terminal FT region of Staphylococcus aureus hypothetical protein Orf FT N031 sa0059 TR:Q9KX82 (EMBL:D86934) (597 aa) fasta scores: FT E(): 2.1e-70, 60.068% id in 293 aa. Similar to N-terminal FT region of SAR0061, 60.068% identity (60.690% ungapped) in FT 293 aa overlap. Possible N-terminal region of a nonsense FT mutated protein" FT /product="hypothetical protein" FT misc_feature complement(82968..82991) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 83654..83779 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0075a" FT /note="Doubtful CDS. No significant database hits" FT /product="hypothetical protein" FT CDS complement(83812..84249) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0076" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein Orf N009 FT TR:Q9KX87 (EMBL:D86934) (124 aa) fasta scores: E(): FT 3.8e-45, 100.000% id in 124 aa CDS is extended at the FT N-terminus in comparison to the previously sequenced FT protein. Possible alternative translational start site" FT /product="hypothetical protein" FT CDS complement(84354..84641) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0077" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein Orf N008 FT TR:Q9KX88 (EMBL:D86934) (95 aa) fasta scores: E(): FT 2.8e-37, 98.947% id in 95 aa" FT /product="putative membrane protein" FT misc_feature complement(84450..84518) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0077 by TMHMM2.0 at aa 42-64" FT CDS complement(84731..85357) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0078" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein Orf N007 FT TR:Q9KX89 (EMBL:D86934) (208 aa) fasta scores: E(): FT 1.1e-78, 100.000% id in 208 aa" FT /product="hypothetical protein" FT CDS 85472..86980 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0079" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical protein TR:Q9XBB4 (EMBL:D86934) (502 aa) FT fasta scores: E(): 9e-192, 99.801% id in 502 aa. Similar FT to Lactococcus lactis serine/threonine protein kinase PknB FT TR:Q9CEF5 (EMBL:AE006418) (627 aa) fasta scores: E(): FT 2.1e-13, 28.527% id in 319 aa. C-terminus is similar to FT SAR0083, 50.000% identity (50.000% ungapped) in 52 aa FT overlap" FT /product="putative protein kinase" FT misc_feature 85919..86395 FT /note="Pfam match to entry PF00069 pkinase, Protein kinase FT domain, score 51.00, E-value 4.7e-13" FT /colour=9 FT repeat_region complement(87007..87023) FT /note="SCC imperfect repeat" FT CDS 87145..89265 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0080" FT /note="No significant database matches to the full length FT CDS. Similar to internal regions of Saccharomyces FT cerevisiae intracellular protein transport protein Uso1 FT SW:USO1_YEAST (P25386) (1790 aa) fasta scores: E(): FT 6.7e-06, 21.105% id in 706 aa, and to Plasmodium chabaudi FT repeat organellar protein TR:Q25662 (EMBL:U43145) (1939 FT aa) fasta scores: E(): 0.00059, 23.381% id in 556 aa" FT /product="hypothetical protein" FT misc_feature 87238..87261 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 89496..89795 FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0081" FT /note="Similar to Bacillus halodurans transposase FT TR:Q9JWP9 (EMBL:AP001518) (94 aa) fasta scores: E(): FT 7e-19, 62.637% id in 91 aa, and to Enterococcus faecium FT transposase TR:O69430 (EMBL:AJ223633) (96 aa) fasta FT scores: E(): 4.2e-18, 63.736% id in 91 aa" FT /product="transposase" FT misc_feature 89529..89786 FT /note="Pfam match to entry PF01527 Transposase_8, FT Transposase, score 83.20, E-value 5.3e-21" FT /colour=9 FT misc_feature 89583..89648 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1264 FT (+3.49 SD) at aa 30-51, sequence KPRNEIIREYDLTPSPLGKWIK" FT CDS 89837..90643 FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0082" FT /note="Similar to Bacillus halodurans transposase FT TR:Q9JWR5 (EMBL:AP001518) (261 aa) fasta scores: E(): FT 2e-49, 52.453% id in 265 aa, and to Enterococcus faecium FT transposase TR:O69429 (EMBL:AJ223633) (282 aa) fasta FT scores: E(): 1.9e-45, 53.252% id in 246 aa" FT /product="transposase" FT misc_feature 90149..90622 FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 140.10, E-value 2.7e-39" FT /colour=9 FT CDS 90670..90831 FT /class="0.0.0" FT /colour=11 FT /locus_tag="SAR0083" FT /note="Poor database matches. Similar to C-terminus of FT Staphylococcus aureus hypothetical protein TR:Q9XBB4 FT (EMBL:D86934) (502 aa) fasta scores: E(): 1.8e-06, 50.000% FT id in 52 aa. Similar to C-terminus of SAR0079, 50.000% FT identity (50.000% ungapped) in 52 aa overlap. Possible FT gene remnant" FT /partial FT /product="hypothetical protein (partial)" FT CDS 90831..91346 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0084" FT /note="Poor database matches. Previously sequenced as FT Staphylococcus aureus hypothetical protein TR:BAB47138 FT (EMBL:AB047239) (171 aa) fasta scores: E(): 4.7e-63, FT 100.000% id in 171 aa" FT /product="hypothetical protein" FT misc_feature complement(91332..92429) FT /note="Insertion sequence ISX" FT /colour=0 FT /label=ISX FT CDS complement(91351..92298) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0085" FT /note="Identical to Staphylococcus aureus transposase FT TR:O87114 (EMBL:AB010124) (328 aa) fasta scores: E(): FT 2.6e-127, 100.000% id in 315 aa, and similar to Bacillus FT halodurans transposase BH3950 TR:Q9JWR3 (EMBL:AP001520) FT (314 aa) fasta scores: E(): 2.9e-71, 58.413% id in 315 aa" FT /product="putative transposase" FT misc_feature complement(91375..91836) FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 119.70, E-value 2.1e-33" FT /colour=9 FT misc_feature complement(91486..91536) FT /colour=8 FT /note="PS01043 Transposases, IS30 family, signature." FT misc_feature complement(92170..92235) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1647 FT (+4.80 SD) at aa 22-43, sequence YSLRSIARKLKRSVSTISREIS" FT CDS 92484..92858 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0086" FT /note="Poor database matches. N-terminal region is FT identical to Staphylococcus aureus hypothetical protein FT TR:BAB47137 (EMBL:AB047239) (82 aa) fasta scores: E(): FT 8.8e-27, 100.000% id in 82 aa. Similar to internal region FT of Saccharomyces cerevisiae hypothetical protein O5254 FT SW:YO7T_YEAST (Q08647) (676 aa) fasta scores: E(): 7, FT 31.000% id in 100 aa" FT /product="hypothetical protein" FT CDS 93145..94848 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0087" FT /note="C-terminal region is similar to the C-terminus of FT Escherichia coli 5-methylcytosine-specific restriction FT enzyme B McrB SW:MCRB_ECOLI (P15005) (459 aa) fasta FT scores: E(): 6.8e-41, 47.284% id in 313 aa, and to an FT internal region of Campylobacter jejuni putative FT endonuclease CJ0139 TR:Q9PIY8 (EMBL:AL139074) (783 aa) FT fasta scores: E(): 7.2e-13, 26.962% id in 586 aa" FT /product="putative restriction enzyme" FT misc_feature 94096..94119 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 94841..95881 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0088" FT /note="Similar to Escherichia coli modulator of the FT specificity of McrB, McrC SW:MCRC_ECOLI (P15006) (348 aa) FT fasta scores: E(): 8.7e-25, 27.746% id in 346 aa. Internal FT region of the CDS is similar to an internal region of FT Campylobacter jejuni hypothetical protein CJ0140 TR:Q9PIY7 FT (EMBL:AL139074) (443 aa) fasta scores: E(): 0.00028, FT 21.862% id in 247 aa" FT /product="putative restriction enzyme modulator protein" FT CDS 96110..96208 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0089" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 96312..96470 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0090" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(96778..96909) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0091" FT /note="Similar to C-terminal regions of Mycobacterium FT tuberculosis insertion sequence IS1534 protein IstB FT TR:AAK48099 (EMBL:AE007172) (248 aa) fasta scores: E(): FT 0.0017, 46.875% id in 32 aa, and to Escherichia coli FT insertion sequence IS21 putative ATP-binding protein IstB FT SW:ISTB_ECOLI (P15026) (265 aa) fasta scores: E(): 0.0062, FT 44.118% id in 34 aa. Probable gene remnant" FT /product="putative insertion sequence protein" FT CDS complement(97309..98280) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0092" FT /note="Similar to Arthrobacter keyseri oxalomesaconate FT hydratase PcmD TR:Q9AGL5 (EMBL:AF331043) (342 aa) fasta FT scores: E(): 5e-05, 23.607% id in 305 aa, and to FT Synechocystis sp hypothetical protein SLR0619 TR:Q55861 FT (EMBL:D64004) (348 aa) fasta scores: E(): 5.6e-12, 25.157% FT id in 318 aa" FT /product="putative hydratase" FT CDS complement(98333..98704) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0093" FT /note="Poor database matches. N-terminal region is similar FT to Staphylococcus carnosus hypothetical protein TR:O54485 FT (EMBL:U96107) (61 aa) fasta scores: E(): 0.005, 36.066% id FT in 61 aa" FT /product="putative membrane protein" FT misc_feature complement(join(98348..98401,98444..98497,98516..98569)) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0093 by TMHMM2.0 at aa 46-63, 70-87 and 102-119" FT CDS complement(98724..100085) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0094" FT /note="Similar to Bacillus subtilis homologue of possible FT multidrug resistance protein YcnB TR:P94422 (EMBL:D50453) FT (472 aa) fasta scores: E(): 2.7e-75, 48.444% id in 450 aa, FT and to Corynebacterium glutamicum possible lincomycin FT resistance protein LmrB TR:Q9L6D2 (EMBL:AF237667) (481 aa) FT fasta scores: E(): 1.1e-52, 36.564% id in 454 aa" FT /product="putative transporter protein" FT misc_feature complement(join(98733..98801,98844..98897,98958..99026,99054..99122,99141..99194,99237..99305,99366..99419,99429..99497,99534..99602,99615..99683,99717..99773,99801..99869,99888..99956,99999..100067)) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0094 by TMHMM2.0 at aa 7-29, 44-66, 73-95, 105-123, FT 135-157, 162-184, 197-219, 223-240, 261-283, 298-315, FT 322-344, 354-376, 397-414 and 429-451" FT misc_feature complement(98742..100067) FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -135.00, E-value 0.055" FT /colour=9 FT misc_feature complement(99972..100085) FT /note="Signal peptide predicted for SAR0094 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.919) with cleavage site FT probability 0.318 between residues 38 and 39" FT /colour=6 FT CDS join(100243..100428,100432..100779,100779..100883,100887..100907,100909..100968,100972..101055) FT /class="7.0.0" FT /colour=11 FT /locus_tag="SAR0095" FT /note="Similar to Bacillus subtilis hypothetical protein FT YvcN SW:YVCN_BACSU (O06977) (254 aa) fasta scores: E(): FT 6.8e-05, 22.500% id in 240 aa, and to Rhizobium loti FT N-hydroxyarylamine O-acetyltransferase MLL5814 TR:BAB52196 FT (EMBL:AP003007) (270 aa) fasta scores: E(): 0.002, 20.623% FT id in 257 aa. Contains nonsense and frameshift mutations" FT /product="putative acetyltransferase (pseudogene)" FT /pseudo FT CDS 101081..101656 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0097" FT /note="Similar to Vibrio cholerae hemagglutinin/protease FT regulatory protein HapR TR:O30343 (EMBL:AF000716) (203 aa) FT fasta scores: E(): 0.24, 23.858% id in 197 aa, and to FT Pasteurella multocida hypothetical protein PM1155 FT TR:Q9CLQ9 (EMBL:AE006156) (199 aa) fasta scores: E(): FT 0.028, 23.280% id in 189 aa" FT /product="putative DNA-binding protein" FT misc_feature 101096..101257 FT /note="Pfam match to entry PF02796 HTH_7, Helix-turn-helix FT domain of resolvase, score 21.90, E-value 0.00041" FT /colour=9 FT misc_feature 101186..101251 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1706 FT (+5.00 SD) at aa 36-57, sequence KKMSDIAKISGVGVGTLYRHFE" FT misc_feature 101192..101278 FT /note="Pfam match to entry PF00440 tetR, Bacterial FT regulatory proteins, tetR family, score 32.40, E-value FT 1.1e-06" FT /colour=9 FT CDS 102126..102599 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0098" FT /note="Similar to Bacillus subtilis hypothetical protein FT YxbD SW:YXBD_BACSU (P46328) (159 aa) fasta scores: E(): FT 4.6e-16, 43.046% id in 151 aa, and to Bacillus subtilis FT hypothetical protein YdhI SW:YDHI_BACSU (O05501) (160 aa) FT fasta scores: E(): 4e-16, 40.132% id in 152 aa" FT /product="acetyltransferase (GNAT) family protein" FT misc_feature 102249..102479 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 50.00, E-value FT 5.2e-11" FT /colour=9 FT CDS complement(102706..103692) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0099" FT /note="Similar to Bacillus subtilis hypothetical protein FT YfjN TR:O31546 (EMBL:Z99108) (325 aa) fasta scores: E(): FT 1.2e-101, 75.385% id in 325 aa, and to Borrelia FT burgdorferi putative histidine phosphokinase/phophatase FT BB0737 TR:O51679 (EMBL:AE001173) (335 aa) fasta scores: FT E(): 1.2e-31, 36.677% id in 319 aa" FT /product="conserved hypothetical protein" FT misc_feature complement(102742..103650) FT /note="Pfam match to entry PF01207 UPF0034, FT Uncharacterized protein family UPF0034, score 123.10, FT E-value 5.3e-33" FT /colour=9 FT misc_feature complement(103342..103398) FT /colour=8 FT /note="PS01136 Uncharacterized protein family UPF0034 FT signature." FT CDS 104041..104202 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0100" FT /note="Similar to internal regions of Sulfolobus FT solfataricus cobalamin biosynthesis protein B CbiB FT TR:AAK43329 (EMBL:AE006912) (305 aa) fasta scores: E(): FT 1.9, 30.612% id in 49 aa, and Methanococcus jannaschii FT hypothetical protein MJ0139 SW:Y139_METJA (Q57603) (209 FT aa) fasta scores: E(): 2.4, 35.417% id in 48 aa" FT /product="putative membrane protein" FT misc_feature join(104050..104103,104107..104175) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0100 by TMHMM2.0 at aa 4-21 and 23-45" FT CDS 104251..104547 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0101" FT /note="Poor database matches. N-terminal region is similar FT to the N-terminus of Spirochaeta aurantia hypothetical FT protein SW:YTR3_SPIAU (P22043) (115 aa) fasta scores: E(): FT 1.5e-05, 35.366% id in 82 aa" FT /product="hypothetical protein" FT CDS 104746..105357 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0102" FT /note="Poor database matches. Similar to internal region FT of Sulfolobus solfataricus multidrug resistance related FT protein SSO0548 TR:AAK40865 (EMBL:AE006685) (393 aa) fasta FT scores: E(): 1.8, 26.066% id in 211 aa, and to C-terminus FT of Coxiella burnetii cell division protein FtsW TR:Q9XCY0 FT (EMBL:AF123260) (372 aa) fasta scores: E(): 4.5, 22.872% FT id in 188 aa" FT /product="putative membrane protein" FT misc_feature join(104755..104823,104908..104976,105004..105072,105106..105174,105232..105291) FT /colour=0 FT /note="5 probable transmembrane helices predicted for FT SAR0102 by TMHMM2.0 at aa 4-26, 55-77, 87-109, 121-143 and FT 163-182" FT CDS 105625..108777 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0103" FT /note="Internal region is similar to an internal region of FT Plasmodium falciparum hypothetical protein PFB0765W FT TR:O96246 (EMBL:AE001417) (980 aa) fasta scores: E(): FT 0.052, 23.104% id in 567 aa, and to N-terminal region of FT Sulfolobus solfataricus purine NTPase SSO2249 TR:AAK42417 FT (EMBL:AE006829) (864 aa) fasta scores: E(): 0.068, 23.700% FT id in 654 aa. Contains coiled-coiled domain, residues 621 FT to 644" FT /product="hypothetical protein" FT misc_feature 106528..106551 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 108860..109342 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0104" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature join(108956..109024,109034..109102,109163..109231,109274..109327) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0104 by TMHMM2.0 at aa 33-55, 59-81, 102-124 and FT 139-156" FT CDS 109547..110533 FT /EC_number="3.1.4.13" FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0105" FT /gene="plc" FT /note="Similar to Staphylococcus aureus FT 1-phosphatidylinositol phosphodiesterase precursor Plc FT SW:PLC_STAAU (P45723) (311 aa) fasta scores: E(): FT 4.6e-114, 95.833% id in 312 aa, and to Bacillus cereus FT 1-phosphatidylinositol phosphodiesterase precursor FT SW:PLC_BACCE (P14262) (329 aa) fasta scores: E(): 5.4e-22, FT 38.650% id in 326 aa" FT /product="1-phosphatidylinositol phosphodiesterase" FT misc_feature 109547..109624 FT /note="Signal peptide predicted for SAR0105 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.971) with cleavage site FT probability 0.706 between residues 26 and 27" FT /colour=6 FT misc_feature 109565..109618 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0105 by TMHMM2.0 at aa 7-24" FT misc_feature 109691..110125 FT /note="Pfam match to entry PF00388 PI-PLC-X, FT Phosphatidylinositol-specific phospholipase C, X domain, FT score 236.10, E-value 5e-67" FT /colour=9 FT CDS 110754..111524 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0106" FT /note="No database matches. Similar to several FT Staphylococcus aureus CDSs, SAR2570, 63.320% identity FT (64.314% ungapped) in 259 aa overlap, SAR0444, 63.118% FT identity (65.613% ungapped) in 263 aa overlap, SAR2573, FT 59.846% identity (61.265% ungapped) in 259 aa overlap and FT SAR0445, 50.000% identity (53.571% ungapped) in 270 aa FT overlap" FT /product="putative lipoprotein" FT misc_feature 110754..110843 FT /note="Signal peptide predicted for SAR0106 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.994) with cleavage site FT probability 0.397 between residues 30 and 31" FT /colour=6 FT misc_feature 110766..110834 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0106 by TMHMM2.0 at aa 5-27" FT misc_feature 110796..110828 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 111618..113855 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0107" FT /note="No significant database matches to the full length FT CDS. N-terminal region is similar to Erwinia chrysanthemi FT arabinose operon regulatory protein AraC SW:ARAC_ERWCH FT (P07642) (310 aa) fasta scores: E(): 1.4e-07, 23.755% id FT in 261 aa, and Bacillus subtilis hypothetical protein YbfI FT TR:O31449 (EMBL:Z99105) (275 aa) fasta scores: E(): FT 1.6e-12, 29.707% id in 239 aa" FT /product="putative regulatory protein" FT misc_feature 112128..112388 FT /note="Pfam match to entry PF00165 HTH_AraC, Bacterial FT regulatory helix-turn-helix proteins, araC family, score FT 99.10, E-value 8.4e-26" FT /colour=9 FT misc_feature 112131..112196 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1860 FT (+5.52 SD) at aa 172-193, sequence LSLSELSEYVGWSESHLSKKFA" FT CDS 114006..115184 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0108" FT /note="Similar to Lactococcus lactis aminoacylase Amd1 FT TR:Q9L9P4 (EMBL:AF168363) (398 aa) fasta scores: E(): FT 8.3e-79, 53.368% id in 386 aa, and to Bacillus halodurans FT N-acyl-L-amino acid amidohydrolase BH1613 TR:Q9KCF8 FT (EMBL:AP001512) (404 aa) fasta scores: E(): 3.7e-62, FT 45.153% id in 392 aa" FT /product="putative peptidase" FT misc_feature 114042..114956 FT /note="Pfam match to entry PF01546 Peptidase_M20, FT Peptidase family M20/M25/M40, score 164.40, E-value FT 3.2e-46" FT /colour=9 FT CDS 115186..116574 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0109" FT /note="Similar to Streptomyces virginiae virginiamycin S FT resistance protein VarS TR:Q9XE01 (EMBL:AB019519) (518 aa) FT fasta scores: E(): 3.6e-23, 26.957% id in 460 aa, and to FT Streptomyces coelicolor putative transmembrane efflux FT protein SCH10.26C TR:Q9X8R5 (EMBL:AL049754) (484 aa) fasta FT scores: E(): 5.6e-24, 27.115% id in 461 aa. Similar to FT SAR1448, 71.082% identity (71.082% ungapped) in 453 aa FT overlap and SAR2534, 59.913% identity (60.706% ungapped) FT in 459 aa overlap" FT /product="putative transporter protein" FT misc_feature 115186..115308 FT /note="Signal peptide predicted for SAR0109 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.950) with cleavage site FT probability 0.596 between residues 41 and 42" FT /colour=6 FT misc_feature join(115204..115263,115321..115389,115423..115491,115501..115554,115591..115659,115669..115728,115786..115854,115864..115923,115984..116052,116068..116136,116173..116232,116242..116310,116392..116460,116473..116541) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0109 by TMHMM2.0 at aa 7-26, 46-68, 80-102, 106-123, FT 136-158, 162-181, 201-223, 227-246, 267-289, 295-317, FT 330-349, 353-375, 403-425 and 430-452" FT misc_feature 115216..116550 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -130.40, E-value 0.038" FT /colour=9 FT misc_feature 116239..116301 FT /colour=8 FT /note="PS00079 Multicopper oxidases signature 1." FT CDS complement(117060..118727) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0110" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH1407 TR:Q9KD12 (EMBL:AP001511) (543 aa) fasta scores: FT E(): 6.4e-87, 48.339% id in 542 aa, and to Streptococcus FT pyogenes hypothetical protein SPY1695 TR:Q99YH9 FT (EMBL:AE006599) (543 aa) fasta scores: E(): 1.2e-74, FT 43.438% id in 541 aa" FT /product="putative Na+/Pi-cotransporter protein" FT misc_feature complement(117420..118652) FT /note="Pfam match to entry PF02690 Na_Pi_cotrans, FT Na+/Pi-cotransporter, score 116.60, E-value 4.6e-31" FT /colour=9 FT misc_feature complement(join(117795..117863,117921..117989,118032..118100,118134..118202,118260..118328,118347..118394,118407..118466,118503..118571,118647..118715)) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0110 by TMHMM2.0 at aa 5-27, 53-75, 88-107, 112-127, FT 134-156, 176-198, 210-232, 247-269 and 289-311" FT CDS complement(119046..120821) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0111" FT /note="Similar to Streptococcus pyogenes 67 kDa FT myosin-crossreactive streptococcal antigen TR:Q54525 FT (EMBL:U09352) (590 aa) fasta scores: E(): 5.5e-143, FT 59.191% id in 593 aa, and to Lactococcus lactis FT myosin-crossreactive antigen MycA TR:Q9CGY7 FT (EMBL:AE006330) (587 aa) fasta scores: E(): 6.6e-151, FT 62.098% id in 591 aa" FT /product="putative myosin-crossreactive antigen" FT CDS 121172..121645 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0112" FT /note="Poor database matches. Similar to Archaeoglobus FT fulgidus hypothetical protein AF0163 TR:O30074 FT (EMBL:AE001095) (183 aa) fasta scores: E(): 0.16, 27.333% FT id in 150 aa, and to Mycoplasma pulmonis hypothetical FT protein TR:CAC13365 (EMBL:AL445563) (167 aa) fasta scores: FT E(): 3.5, 27.481% id in 131 aa" FT /product="putative membrane protein" FT misc_feature 121172..121252 FT /note="Signal peptide predicted for SAR0112 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.971) with cleavage site FT probability 0.606 between residues 27 and 28" FT /colour=6 FT misc_feature join(121190..121249,121322..121390,121451..121519,121547..121615) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0112 by TMHMM2.0 at aa 7-26, 51-73, 94-116 and 126-148" FT CDS 121907..123499 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0113" FT /gene="lldP1" FT /note="Similar to Escherichia coli L-lactate permease LldP FT SW:LLDP_ECOLI (P33231) (551 aa) fasta scores: E(): FT 1.2e-49, 43.414% id in 539 aa, and to Bacillus halodurans FT L-lactate permease LctP TR:Q9K5Z9 (EMBL:AP001520) (524 aa) FT fasta scores: E(): 2.3e-115, 59.322% id in 531 aa. Similar FT to SAR2455, 65.977% identity (66.352% ungapped) in 532 aa FT overlap" FT /product="L-lactate permease 1" FT misc_feature 121907..122026 FT /note="Signal peptide predicted for SAR0113 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.808) with cleavage site FT probability 0.669 between residues 40 and 41" FT /colour=6 FT misc_feature join(121940..122008,122018..122086,122105..122173,122285..122353,122372..122440,122483..122551,122576..122644,122654..122707,122783..122851,122948..123016,123077..123145,123173..123241,123440..123493) FT /colour=0 FT /note="13 probable transmembrane helices predicted for FT SAR0113 by TMHMM2.0 at aa 12-34, 38-60, 67-89, 127-149, FT 156-178, 193-215, 224-246, 250-267, 293-315, 348-370, FT 391-413, 423-445 and 512-529" FT misc_feature 121946..123484 FT /note="Pfam match to entry PF02652 Lactate_perm, L-lactate FT permease, score 666.20, E-value 1.6e-196" FT /colour=9 FT misc_feature 123452..123481 FT /colour=8 FT /note="PS00904 Protein prenyltransferases alpha subunit FT repeat signature." FT CDS complement(123828..125378) FT /class="4.1.8" FT /colour=3 FT /locus_tag="SAR0114" FT /gene="spa" FT /note="Previously sequenced as Staphylococcus aureus FT immunoglobulin G binding protein A precursor Spa FT SW:SPA2_STAAU (P38507) (508 aa) fasta scores: E(): FT 1.6e-150, 98.062% id in 516 aa. Similar to Staphylococcus FT carnosus human serum albumin-binding cell surface FT precursor PPMABPXM TR:Q53833 (EMBL:U15516) (666 aa) fasta FT scores: E(): 2.6e-53, 50.484% id in 517 aa. Probable FT LPXTG-sorted surface protein" FT /product="immunoglobulin G binding protein A precursor" FT misc_feature complement(123837..123959) FT /note="Pfam match to entry PF00746 Gram_pos_anchor, Gram FT positive anchor, score 52.10, E-value 1.3e-11" FT /colour=9 FT misc_feature complement(123918..123935) FT /colour=8 FT /note="PS00343 Gram-positive cocci surface proteins FT 'anchoring' hexapeptide." FT misc_feature complement(123981..124112) FT /note="Pfam match to entry PF01476 LysM, LysM domain, FT score 58.40, E-value 1.6e-13" FT /colour=9 FT misc_feature complement(124410..124571) FT /note="Pfam match to entry PF02216 B, B domain, score FT 120.30, E-value 3.6e-32" FT /colour=9 FT misc_feature complement(124584..124745) FT /note="Pfam match to entry PF02216 B, B domain, score FT 124.80, E-value 1.6e-33" FT /colour=9 FT misc_feature complement(124758..124919) FT /note="Pfam match to entry PF02216 B, B domain, score FT 123.50, E-value 3.8e-33" FT /colour=9 FT misc_feature complement(124932..125093) FT /note="Pfam match to entry PF02216 B, B domain, score FT 127.80, E-value 2e-34" FT /colour=9 FT misc_feature complement(125115..125276) FT /note="Pfam match to entry PF02216 B, B domain, score FT 124.10, E-value 2.6e-33" FT /colour=9 FT misc_feature complement(125271..125378) FT /note="Signal peptide predicted for SAR0114 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.783 between residues 36 and 37" FT /colour=6 FT misc_feature complement(125277..125345) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0114 by TMHMM2.0 at aa 12-34" FT CDS complement(125799..126551) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0115" FT /note="C-terminus is similar to Staphylococcus aureus FT staphylococcal accessory regulator A SarA TR:Q53777 FT (EMBL:U46541) (113 aa) fasta scores: E(): 1.1e-07, 35.849% FT id in 106 aa. Full length CDS is similar to Staphylococcus FT aureus Rot-like protein, agr locus activator, Rlp FT TR:Q9EZK4 (EMBL:AF288788) (247 aa) fasta scores: E(): FT 1.9e-29, 38.683% id in 243 aa" FT /product="putative regulatory protein" FT CDS complement(126920..127918) FT /class="1.5.5" FT /colour=3 FT /locus_tag="SAR0116" FT /gene="sirC" FT /note="Similar to Erwinia chrysanthemi achromobactin FT transport system permease protein CbrC SW:CBRC_ERWCH FT (Q47086) (349 aa) fasta scores: E(): 3.1e-36, 37.309% id FT in 327 aa. Previously sequenced as Staphylococcus aureus FT putative siderophore transport protein SirC TR:O87493 FT (EMBL:AF079518) (332 aa) fasta scores: E(): 7.1e-108, FT 97.289% id in 332 aa" FT /product="putative siderophore transport system permease" FT misc_feature complement(join(126932..126991,127010..127078,127121..127189,127280..127333,127406..127474,127508..127576,127586..127639,127676..127744,127814..127882)) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0116 by TMHMM2.0 at aa 13-35, 59-81, 94-111, 115-137, FT 149-171, 196-213, 244-266, 281-303 and 310-329" FT misc_feature complement(126935..127828) FT /note="Pfam match to entry PF01032 FecCD_family, FecCD FT transport family, score 269.80, E-value 3.7e-77" FT /colour=9 FT misc_feature complement(127823..127918) FT /note="Signal peptide predicted for SAR0116 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.899) with cleavage site FT probability 0.581 between residues 32 and 33" FT /colour=6 FT CDS complement(127915..128910) FT /class="1.5.5" FT /colour=3 FT /locus_tag="SAR0117" FT /gene="sirB" FT /note="Similar to Erwinia chrysanthemi achromobactin FT transport system permease protein CbrB SW:CBRB_ERWCH FT (Q47085) (340 aa) fasta scores: E(): 1.5e-44, 43.077% id FT in 325 aa. Previously sequenced as Staphylococcus aureus FT putative siderophore transport protein SirB TR:O87492 FT (EMBL:AF079518) (331 aa) fasta scores: E(): 5.9e-109, FT 99.396% id in 331 aa" FT /product="putative siderophore transport system permease" FT misc_feature complement(127933..128832) FT /note="Pfam match to entry PF01032 FecCD_family, FecCD FT transport family, score 340.80, E-value 1.6e-98" FT /colour=9 FT misc_feature complement(join(127942..127995,128008..128076,128134..128202,128260..128328,128401..128469,128497..128565,128584..128640,128668..128727,128815..128883)) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0117 by TMHMM2.0 at aa 10-32, 62-81, 91-109, 116-138, FT 148-170, 195-217, 237-259, 279-301 and 306-323" FT misc_feature complement(128818..128910) FT /note="Signal peptide predicted for SAR0117 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.500 between residues 31 and 32" FT /colour=6 FT CDS complement(128926..129918) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0118" FT /gene="sirA" FT /note="Previously sequenced as Staphylococcus aureus FT iron-regulated lipoprotein SirA TR:O87491 (EMBL:AF079518) FT (330 aa) fasta scores: E(): 6.5e-114, 99.697% id in 330 FT aa. Similar to Erwinia chrysanthemi achromobactin-binding FT periplasmic protein precursor CbrA SW:CBRA_ERWCH (Q47084) FT (305 aa) fasta scores: E(): 3.2e-28, 36.431% id in 269 aa" FT /product="lipoprotein" FT misc_feature complement(129025..129762) FT /note="Pfam match to entry PF01497 Peripla_BP_2, FT Periplasmic binding protein, score 176.60, E-value 4e-49" FT /colour=9 FT misc_feature complement(129838..129918) FT /note="Signal peptide predicted for SAR0118 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.559 between residues 27 and 28" FT /colour=6 FT misc_feature complement(129856..129888) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 130149..131129 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0119" FT /note="Similar to Alcaligenes eutrophus putative cysteine FT synthase CysM SW:CYSM_ALCEU (Q44004) (339 aa) fasta FT scores: E(): 2.3e-48, 45.231% id in 325 aa, and to FT Helicobacter pylori J99 putative cysteine synthase CysM FT SW:CYSM_HELPJ (Q9ZMW6) (305 aa) fasta scores: E(): 4e-30, FT 34.098% id in 305 aa" FT /product="pyridoxal-phosphate dependent enzyme" FT misc_feature 130182..131048 FT /note="Pfam match to entry PF00291 PALP, FT Pyridoxal-phosphate dependent enzyme, score 273.70, FT E-value 2.5e-78" FT /colour=9 FT CDS 131126..132136 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0120" FT /note="Similar to Rhizobium meliloti ornithine FT cyclodeaminase Ocd SW:OCD_RHIME (P33728) (320 aa) fasta FT scores: E(): 3e-14, 22.727% id in 330 aa, and to FT Archaeoglobus fulgidus ornithine cyclodeaminase AF1665 FT TR:O28608 (EMBL:AE000988) (322 aa) fasta scores: E(): FT 2.5e-25, 31.953% id in 338 aa" FT /product="putative ornithine cyclodeaminase" FT misc_feature 131132..132109 FT /note="Pfam match to entry PF02423 ODC_Mu_crystall, FT Ornithine cyclodeaminase/mu-crystallin family, score FT 176.30, E-value 5.1e-49" FT /colour=9 FT CDS 132157..133911 FT /class="1.6.3" FT /colour=0 FT /locus_tag="SAR0121" FT /note="C-terminal region is similar to C-terminus of FT Escherichia coli aerobactin siderophore biosynthesis FT protein IucC SW:IUCC_ECOLI (Q47318) (580 aa) fasta scores: FT E(): 6.1e-10, 25.926% id in 459 aa. Full length CDS is FT similar to Bacillus halodurans hypothetical protein BH2618 FT TR:Q9K9M7 (EMBL:AP001516) (601 aa) fasta scores: E(): FT 3.1e-13, 22.165% id in 582 aa" FT /product="putative siderophore biosynthesis protein" FT CDS 133904..135160 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0122" FT /note="Similar to Streptococcus pneumoniae multi-drug FT resistance efflux pump PmrA TR:Q9ZEX9 (EMBL:AJ007367) (399 FT aa) fasta scores: E(): 3.4e-23, 25.123% id in 406 aa, and FT to Lactococcus lactis multidrug resistance efflux pump FT PmrB TR:Q9CJ75 (EMBL:AE006250) (398 aa) fasta scores: E(): FT 6e-29, 26.873% id in 387 aa" FT /product="putative transport protein" FT misc_feature 133904..134071 FT /note="Signal peptide predicted for SAR0122 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.803) with cleavage site FT probability 0.509 between residues 56 and 57" FT /colour=6 FT misc_feature join(133940..134008,134051..134119,134156..134224,134393..134461,134567..134635,134678..134731,134765..134824,134852..134920,134939..135007,135035..135094) FT /colour=0 FT /note="10 probable transmembrane helices predicted for FT SAR0122 by TMHMM2.0 at aa 13-35, 50-72, 85-107, 164-186, FT 222-244, 259-276, 288-307, 317-339, 346-368 and 378-397" FT misc_feature 133949..135127 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -82.40, E-value 0.00076" FT /colour=9 FT CDS 135150..136886 FT /class="1.6.3" FT /colour=0 FT /locus_tag="SAR0123" FT /note="Similar to Rhizobium meliloti rhizobactin FT siderophore biosynthesis protein RhsC SW:RHSC_RHIME FT (Q9Z3R0) (585 aa) fasta scores: E(): 2.6e-31, 26.723% id FT in 595 aa, and to Escherichia coli aerobactin siderophore FT biosynthesis protein IucA SW:IUCA_ECOLI (Q47316) (575 aa) FT fasta scores: E(): 3.4e-23, 23.639% id in 588 aa" FT /product="putative siderophore biosynthesis protein" FT CDS 136867..138645 FT /class="1.6.3" FT /colour=0 FT /locus_tag="SAR0124" FT /note="Similar to Rhizobium meliloti rhizobactin FT siderophore biosynthesis protein RhsF SW:RHSF_RHIME FT (Q9Z3Q7) (601 aa) fasta scores: E(): 3.5e-43, 28.571% id FT in 560 aa, and to Escherichia coli aerobactin siderophore FT biosynthesis protein IucC SW:IUCC_ECOLI (Q47318) (580 aa) FT fasta scores: E(): 1.1e-28, 24.912% id in 566 aa" FT /product="putative siderophore biosynthesis protein" FT CDS 138620..139396 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0125" FT /note="Similar to Escherichia coli FT 5-keto-4-deoxy-D-glucarate aldolase GarL SW:GARL_ECOLI FT (P23522) (256 aa) fasta scores: E(): 3.2e-17, 29.832% id FT in 238 aa, and to Rhizobium loti 4-hydroxy-2-oxovalerate FT aldolase MLL5426 TR:BAB51880 (EMBL:AP003006) (264 aa) FT fasta scores: E(): 1.5e-21, 34.956% id in 226 aa" FT /product="putative aldolase" FT CDS 139396..140598 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0126" FT /note="Similar to Pseudomonas fluorescens diaminopimelate FT decarboxylase LysA SW:DCDA_PSEFL (O05321) (416 aa) fasta FT scores: E(): 5.1e-16, 27.671% id in 365 aa, and to FT Bacillus circulans butirosin-biosynthetic gene cluster FT protein BtrK TR:Q9F1Z3 (EMBL:AB033991) (428 aa) fasta FT scores: E(): 4.8e-30, 31.152% id in 382 aa" FT /product="pyridoxal-dependent decarboxylase decarboxylase" FT misc_feature 139465..140094 FT /note="Pfam match to entry PF02784 Orn_Arg_deC_N, FT Pyridoxal-dependent decarboxylase, pyridoxal binding FT domain, score 78.60, E-value 2.1e-22" FT /colour=9 FT misc_feature 140032..140085 FT /colour=8 FT /note="PS00879 Orn/DAP/Arg decarboxylases family 2 FT signature 2." FT CDS 140602..141366 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0127" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 141562..142188 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0128" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature join(141619..141687,141730..141798,141835..141903) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0128 by TMHMM2.0 at aa 20-42, 57-79 and 92-114" FT CDS 142399..143175 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0129" FT /note="Similar to Lactococcus lactis diacetyl-acetoin FT reductase Dar TR:Q9RLV7 (EMBL:AJ012388) (256 aa) fasta FT scores: E(): 2.4e-38, 48.221% id in 253 aa, and to FT Klebsiella pneumoniae acetoin BudC SW:BUDC_KLEPN (Q48436) FT (256 aa) fasta scores: E(): 4e-53, 58.893% id in 253 aa" FT /product="putative short chain dehydrogenase" FT misc_feature 142405..143163 FT /note="Pfam match to entry PF00106 adh_short, short chain FT dehydrogenase, score 281.00, E-value 1.5e-80" FT /colour=9 FT misc_feature 142819..142905 FT /colour=8 FT /note="PS00061 Short-chain dehydrogenases/reductases FT family signature." FT CDS complement(143224..143337) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0130a" FT /note="Doubtful CDS. No significant database hits" FT /product="hypothetical protein" FT CDS 143519..144490 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0130" FT /note="Similar to Salmonella typhi Vi antigen FT polysaccharide biosynthesis protein VipB SW:VIPB_SALTI FT (Q04973) (348 aa) fasta scores: E(): 1.3e-27, 34.756% id FT in 328 aa, and to Lactococcus lactis putative UDP-glucose FT 4-epimerase YcbD TR:Q9CIZ5 (EMBL:AE006259) (313 aa) fasta FT scores: E(): 9.7e-48, 41.967% id in 305 aa" FT /product="NAD dependent epimerase/dehydratase family FT protein" FT misc_feature 143528..144454 FT /note="Pfam match to entry PF01370 Epimerase, NAD FT dependent epimerase/dehydratase family, score 280.50, FT E-value 2.2e-80" FT /colour=9 FT CDS 144453..145142 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0131" FT /note="Similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5M TR:P95706 FT (EMBL:U81973) (185 aa) fasta scores: E(): 1.7e-21, 41.622% FT id in 185 aa, and to Bacillus halodurans teichuronic acid FT biosynthesis protein TuaA TR:Q9K6S6 (EMBL:AP001519) (205 FT aa) fasta scores: E(): 1.2e-24, 47.531% id in 162 aa" FT /product="putative sugar transferase" FT misc_feature 144582..145139 FT /note="Pfam match to entry PF02397 Bact_transf, Bacterial FT sugar transferase, score 150.30, E-value 3.5e-41" FT /colour=9 FT misc_feature 144597..144665 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0131 by TMHMM2.0 at aa 49-71" FT CDS 145352..146518 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0132" FT /note="Similar to Streptococcus pneumoniae galactosyl FT transferase Cap8H TR:Q9X9A5 (EMBL:AJ239004) (354 aa) fasta FT scores: E(): 3.2e-08, 24.510% id in 306 aa, and to FT Thermotoga maritima putative lipopolysaccharide FT biosynthesis protein TM0622 TR:Q9WZ90 (EMBL:AE001736) (388 FT aa) fasta scores: E(): 1.9e-10, 25.000% id in 396 aa" FT /product="galactosyl transferase" FT misc_feature 145943..146443 FT /note="Pfam match to entry PF00534 Glycos_transf_1, FT Glycosyl transferases group 1, score 112.80, E-value FT 3.6e-30" FT /colour=9 FT CDS 146499..147737 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0133" FT /note="Similar to Streptococcus pneumoniae type 2 capsular FT polysaccharide biosynthesis protein Cps2H TR:Q9ZII1 FT (EMBL:AF026471) (387 aa) fasta scores: E(): 0.00016, FT 23.558% id in 416 aa, and to Actinobacillus FT actinomycetemcomitans (Haemophilus actinomycetemcomitans) FT serotype d-specific polysaccharide biosynthetesis protein FT TR:Q9JRS0 (EMBL:AB041266) (431 aa) fasta scores: E(): FT 0.0017, 21.362% id in 426 aa" FT /product="putative membrane protein" FT misc_feature 146499..146582 FT /note="Signal peptide predicted for SAR0133 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.952) with cleavage site FT probability 0.702 between residues 28 and 29" FT /colour=6 FT misc_feature join(146523..146582,146592..146660,146673..146741,146769..146837,146856..146924,146994..147062,147081..147149,147192..147260,147366..147434,147492..147560,147579..147647,147660..147704) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0133 by TMHMM2.0 at aa 9-28, 32-54, 59-81, 91-113, FT 120-142, 166-188, 195-217, 232-254, 290-312, 332-354, FT 361-383 and 388-402" FT CDS 147727..149157 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0134" FT /note="Similar to Yersinia enterocolitica FT lipopolysaccharide O-unit flippase TrsA TR:Q56913 FT (EMBL:Z47767) (418 aa) fasta scores: E(): 7.6e-18, 24.257% FT id in 404 aa, and to Streptococcus thermophilus FT hypothetical protein EpsI TR:AAK61904 (EMBL:AF373595) (471 FT aa) fasta scores: E(): 5.2e-46, 30.917% id in 469 aa" FT /product="polysaccharide biosynthesis protein" FT misc_feature 147742..148545 FT /note="Pfam match to entry PF01943 Polysacc_synt, FT Polysaccharide biosynthesis protein, score 117.70, E-value FT 2.2e-31" FT /colour=9 FT misc_feature join(147853..147921,147982..148050,148063..148131,148150..148209,148237..148296,148387..148455,148465..148524,148600..148668,148681..148749,148786..148854,148864..148923,148948..149016,149026..149094) FT /colour=0 FT /note="13 probable transmembrane helices predicted for FT SAR0134 by TMHMM2.0 at aa 43-65, 86-108, 113-135, 142-161, FT 171-190, 221-243, 247-266, 292-314, 319-341, 354-376, FT 380-399, 408-430 and 434-456" FT CDS 149425..150024 FT /class="1.4.2" FT /colour=0 FT /locus_tag="SAR0135" FT /gene="sodM" FT /note="Previously sequenced as Staphylococcus aureus FT superoxide dismutase SodM TR:Q9EZZ2 (EMBL:AF273269) (187 FT aa) fasta scores: E(): 6.2e-77, 100.000% id in 187 aa. FT Similar to Staphylococcus xylosus superoxide dismutase Sod FT TR:Q9K4V3 (EMBL:AJ276960) (199 aa) fasta scores: E(): FT 2.5e-65, 76.382% id in 199 aa. Similar to SAR1630, 74.874% FT identity (74.874% ungapped) in 199 aa overlap" FT /product="superoxide dismutase" FT misc_feature 149425..149691 FT /note="Pfam match to entry PF00081 sodfe, Iron/manganese FT superoxide dismutases, alpha-hairpin domain, score 173.70, FT E-value 2.5e-51" FT /colour=9 FT misc_feature 149707..150021 FT /note="Pfam match to entry PF02777 sodfe_C, Iron/manganese FT superoxide dismutases, C-terminal domain, score 209.90, FT E-value 1.3e-63" FT /colour=9 FT misc_feature 149905..149928 FT /colour=8 FT /note="PS00088 Manganese and iron superoxide dismutases FT signature." FT CDS 150393..151058 FT /class="4.1.8" FT /colour=3 FT /locus_tag="SAR0136" FT /gene="sasD" FT /note="No significant database matches. Possible FT LPXAG-sorted surface protein" FT /product="putative surface anchored protein" FT misc_feature 150393..150476 FT /note="Signal peptide predicted for SAR0136 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.993 between residues 28 and 29" FT /colour=6 FT misc_feature 150966..151034 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0136 by TMHMM2.0 at aa 192-214" FT CDS complement(151160..151900) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0137" FT /note="Similar to Pseudomonas fluorescens transcriptional FT repressor of the trehalose operon TreR TR:Q9F8X4 FT (EMBL:AF229829) (234 aa) fasta scores: E(): 7.1e-05, FT 26.267% id in 217 aa, and to Streptococcus pyogenes FT putative transcriptional regulator SPY1870 TR:Q99Y48 FT (EMBL:AE006612) (247 aa) fasta scores: E(): 8.3e-19, FT 28.879% id in 232 aa" FT /product="GntR family regulatory protein" FT misc_feature complement(151691..151870) FT /note="Pfam match to entry PF00392 gntR, Bacterial FT regulatory proteins, gntR family, score 76.00, E-value FT 6.2e-22" FT /colour=9 FT misc_feature complement(151739..151813) FT /colour=8 FT /note="PS00043 Bacterial regulatory proteins, gntR family FT signature." FT misc_feature complement(151745..151810) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1559 FT (+4.50 SD) at aa 31-52, sequence PTEKELCARFDVSRMTLRQAIK" FT CDS 152151..152858 FT /class="3.3.11" FT /colour=6 FT /locus_tag="SAR0138" FT /gene="deoD1" FT /note="Similar to Escherichia coli purine nucleoside FT phosphorylase DeoD SW:DEOD_ECOLI (P09743) (238 aa) fasta FT scores: E(): 1.8e-41, 50.638% id in 235 aa, and to Vibrio FT cholerae purine nucleoside phosphorylase VCA0053 TR:Q9KNB2 FT (EMBL:AE004349) (245 aa) fasta scores: E(): 1.1e-44, FT 52.814% id in 231 aa. Similar to SAR2226, 66.953% identity FT (67.241% ungapped) in 233 aa overlap" FT /product="putative purine nucleoside phosphorylase" FT misc_feature 152199..152855 FT /note="Pfam match to entry PF01048 PNP_UDP_1, FT Phosphorylase family, score 295.70, E-value 5.7e-85" FT /colour=9 FT misc_feature 152340..152387 FT /colour=8 FT /note="PS01232 Purine and other phosphorylases family 1 FT signature." FT CDS 152865..154217 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0139" FT /note="Similar to Bacillus subtilis tetracycline FT resistance protein TetB SW:TCRB_BACSU (P23054) (458 aa) FT fasta scores: E(): 2.2e-28, 26.201% id in 458 aa, and to FT Staphylococcus hyicus tetracycline resistance protein Tet FT SW:TCR_STAHY (P36890) (458 aa) fasta scores: E(): 6.8e-28, FT 25.764% id in 458 aa" FT /product="putative transport system protein" FT misc_feature 152865..152975 FT /note="Signal peptide predicted for SAR0139 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.973) with cleavage site FT probability 0.775 between residues 37 and 38" FT /colour=6 FT misc_feature 152889..154199 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -114.50, E-value 0.01" FT /colour=9 FT misc_feature join(152898..152966,153003..153071,153090..153158,153168..153236,153270..153338,153351..153419,153456..153509,153522..153575,153636..153704,153732..153791,153825..153884,153894..153962,153999..154067,154125..154193) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0139 by TMHMM2.0 at aa 12-34, 47-69, 76-98, 102-124, FT 136-158, 163-185, 198-215, 220-237, 258-280, 290-309, FT 321-340, 344-366, 379-401 and 421-443" FT CDS 154298..154960 FT /class="3.3.11" FT /colour=6 FT /locus_tag="SAR0140" FT /gene="deoC1" FT /note="Similar to Mycoplasma pneumoniae FT deoxyribose-phosphate aldolase DeoC SW:DEOC_MYCPN (P09924) FT (224 aa) fasta scores: E(): 5.3e-28, 46.262% id in 214 aa, FT and to Lactococcus lactis deoxyribose-phosphate aldolase FT DeoC SW:DEOC_LACLA (Q9CFM7) (220 aa) fasta scores: E(): FT 4.3e-43, 60.000% id in 220 aa. Similar to SAR2225, 96.818% FT identity (96.818% ungapped) in 220 aa overlap" FT /product="deoxyribose-phosphate aldolase" FT misc_feature 154298..154933 FT /note="Pfam match to entry PF01791 DeoC, FT Deoxyribose-phosphate aldolase, score 350.70, E-value FT 1.6e-101" FT /colour=9 FT CDS 154988..156166 FT /EC_number="5.4.2.7" FT /class="3.3.17" FT /colour=7 FT /locus_tag="SAR0141" FT /gene="drm" FT /note="Similar to Bacillus subtilis phosphopentomutase Drm FT SW:DEOB_BACSU (P46353) (396 aa) fasta scores: E(): FT 6.3e-97, 64.706% id in 391 aa, and to Bacillus FT stearothermophilus phosphopentomutase Ppm TR:O24821 FT (EMBL:AB008120) (393 aa) fasta scores: E(): 6e-98, 65.296% FT id in 389 aa" FT /product="putative phosphopentomutase" FT misc_feature 155633..155656 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 155753..156082 FT /note="Pfam match to entry PF01676 Metalloenzyme, FT Metalloenzyme superfamily, score 129.00, E-value 8.6e-35" FT /colour=9 FT CDS complement(156297..157112) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0142" FT /note="Similar to Escherichia coli phosphonates transport FT system permease protein PhnE SW:PHNE_ECOLI (P16683) (276 FT aa) fasta scores: E(): 5.6e-26, 35.341% id in 249 aa, and FT to Bacillus halodurans phosphonates transport system FT protein BH0442 TR:Q9KFN7 (EMBL:AP001508) (267 aa) fasta FT scores: E(): 8.5e-49, 52.896% id in 259 aa" FT /product="binding-protein-dependent transport systems FT membrane component" FT misc_feature complement(join(156315..156374,156402..156470,156489..156542,156696..156764,156798..156866,156978..157046)) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0142 by TMHMM2.0 at aa 23-45, 83-105, 117-139, 191-208, FT 215-237 and 247-266" FT misc_feature complement(156399..156611) FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 29.30, E-value 9.1e-05" FT /colour=9 FT misc_feature complement(156978..157112) FT /note="Signal peptide predicted for SAR0142 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.924) with cleavage site FT probability 0.273 between residues 45 and 46" FT /colour=6 FT CDS complement(157109..157909) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0143" FT /note="Similar to Escherichia coli phosphonates transport FT system permease protein PhnE SW:PHNE_ECOLI (P16683) (276 FT aa) fasta scores: E(): 2.3e-27, 36.032% id in 247 aa, and FT to Bacillus halodurans phosphonates transport system FT BH0441 TR:Q9KFN8 (EMBL:AP001508) (263 aa) fasta scores: FT E(): 1.6e-44, 49.615% id in 260 aa" FT /product="binding-protein-dependent transport system FT membrane component" FT misc_feature complement(join(157148..157216,157289..157357,157418..157477,157490..157558,157595..157663,157781..157849)) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0143 by TMHMM2.0 at aa 21-43, 83-105, 118-140, 145-164, FT 185-207 and 232-254" FT misc_feature complement(157193..157423) FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 27.40, E-value 0.00032" FT /colour=9 FT CDS complement(157911..158684) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0144" FT /note="Similar to Escherichia coli phosphonates transport FT ATP-binding protein PhnC SW:PHNC_ECOLI (P16677) (262 aa) FT fasta scores: E(): 2e-30, 43.750% id in 256 aa, and to FT Bacillus halodurans transport system protein BH0440 FT TR:Q9KFN9 (EMBL:AP001508) (257 aa) fasta scores: E(): FT 4.2e-57, 69.841% id in 252 aa" FT /product="putative ABC transport ATP-binding protein" FT misc_feature complement(158013..158597) FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 176.90, E-value 3.2e-49" FT /colour=9 FT misc_feature complement(158199..158243) FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT misc_feature complement(158553..158576) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(158898..159854) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0145" FT /note="Similar to an internal region of Escherichia coli FT phosphonates-binding periplasmic protein precursor PhnD FT SW:PHND_ECOLI (P16682) (338 aa) fasta scores: E(): FT 7.5e-10, 24.101% id in 278 aa. Full length CDS is similar FT to Bacillus halodurans hypothetical protein BH0439 FT TR:Q9KFP0 (EMBL:AP001508) (317 aa) fasta scores: E(): FT 1.4e-55, 54.693% id in 309 aa" FT /product="putative lipoprotein" FT misc_feature complement(159777..159836) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0145 by TMHMM2.0 at aa 7-26" FT misc_feature complement(159789..159854) FT /note="Signal peptide predicted for SAR0145 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.259 between residues 22 and 23" FT /colour=6 FT misc_feature complement(159792..159824) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 160083..161627 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0146" FT /note="No significant database matches to the full length FT CDS. Internal region of CDS is similar to an internal FT region Arabidopsis thaliana hypothetical protein F4P12_240 FT TR:Q9LFG5 (EMBL:AL132966) (932 aa) fasta scores: E(): 1, FT 24.390% id in 328 aa" FT /product="putative exported protein" FT misc_feature 160083..160163 FT /note="Signal peptide predicted for SAR0146 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.609 between residues 27 and 28" FT /colour=6 FT CDS 161678..163213 FT /class="3.3.10" FT /colour=6 FT /locus_tag="SAR0147" FT /note="Similar to Escherichia coli 2',3'-cyclic-nucleotide FT 2'-phosphodiesterase CpdB SW:CN16_ECOLI (P08331) (647 aa) FT fasta scores: E(): 5.4e-09, 25.279% id in 538 aa, and to FT Lactococcus lactis putative phosphatase YcjM TR:Q9CIQ3 FT (EMBL:AE006267) (519 aa) fasta scores: E(): 7.5e-74, FT 38.477% id in 512 aa" FT /product="putative nucleotidase" FT misc_feature 161705..162511 FT /note="Pfam match to entry PF01009 5_nucleotidase, FT 5'-nucleotidase, catalytic domain, score 133.60, E-value FT 2.6e-38" FT /colour=9 FT misc_feature 161933..161968 FT /colour=8 FT /note="PS00786 5'-nucleotidase signature 2." FT misc_feature 162638..163129 FT /note="Pfam match to entry PF02872 5_nucleotidaseC, FT 5'-nucleotidase, C-terminal domain, score 38.30, E-value FT 1.7e-07" FT /colour=9 FT CDS 163370..164137 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0148" FT /note="Poor database matches. Similar to Borrelia FT burgdorferi plasmid hypothetical protein TR:Q44710 FT (EMBL:U03641) (371 aa) fasta scores: E(): 0.89, 22.222% id FT in 234 aa" FT /product="hypothetical protein" FT CDS 164143..165318 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0149" FT /note="Poor database matches. Similar to Neisseria FT meningitidis transcriptional regulator NMB2012 TR:Q9JXJ6 FT (EMBL:AE002551) (363 aa) fasta scores: E(): 3e-09, 25.714% FT id in 350 aa, and to Mycobacterium tuberculosis putative FT DNA-binding protein MT2073 TR:AAK46351 (EMBL:AE007058) FT (346 aa) fasta scores: E(): 0.0001, 28.012% id in 332 aa" FT /product="putative DNA-binding protein" FT misc_feature 164161..164325 FT /note="Pfam match to entry PF01381 HTH_3, FT Helix-turn-helix, score 32.00, E-value 1.4e-05" FT /colour=9 FT misc_feature 164188..164253 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1894 FT (+5.64 SD) at aa 16-37, sequence LSRKELSEKINVSEQAIWQYET" FT CDS 165704..168313 FT /EC_number="1.1.1.1" FT /class="3.5.2" FT /colour=7 FT /locus_tag="SAR0150" FT /gene="adhE" FT /note="Similar to Escherichia coli aldehyde-alcohol FT dehydrogenase [includes: alcohol dehydrogenase, FT acetaldehyde dehydrogenase and FT pyruvate-formate-lyase-deactivase] AdhE SW:ADHE_ECOLI FT (P17547) (890 aa) fasta scores: E(): 3.4e-140, 48.601% id FT in 858 aa, and to Entamoeba histolytica aldehyde-alcohol FT dehydrogenase 2 [includes: alcohol dehydrogenase, FT acetaldehyde dehydrogenase, and FT pyruvate-formate-lyase-deactivase] Adh2 SW:ADH2_ENTHI FT (Q24803) (870 aa) fasta scores: E(): 4.8e-170, 52.887% id FT in 866 aa" FT /product="putative aldehyde-alcohol dehydrogenase" FT misc_feature 165719..167077 FT /note="Pfam match to entry PF00171 aldedh, Aldehyde FT dehydrogenase family, score -175.10, E-value 1.2e-06" FT /colour=9 FT misc_feature 167102..168274 FT /note="Pfam match to entry PF00465 Fe-ADH, Iron-containing FT alcohol dehydrogenase, score 491.50, E-value 6.4e-144" FT /colour=9 FT misc_feature 167621..167707 FT /colour=8 FT /note="PS00913 Iron-containing alcohol dehydrogenases FT signature 1." FT misc_feature 167879..167941 FT /colour=8 FT /note="PS00060 Iron-containing alcohol dehydrogenases FT signature 2." FT CDS 168658..169326 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0151" FT /gene="capA" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5A TR:P95695 FT (EMBL:U81973) (222 aa) fasta scores: E(): 1.3e-72, 99.550% FT id in 222 aa, and to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8A TR:P72367 FT (EMBL:U73374) (222 aa) fasta scores: E(): 5.2e-72, 98.649% FT id in 222 aa, Similar to SAR2745, 52.489% identity FT (52.727% ungapped) in 221 aa overlap" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature join(168715..168783,169171..169230) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0151 by TMHMM2.0 at aa 20-42 and 172-191" FT CDS 169342..170028 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0152" FT /gene="capB" FT /note="Highly imilar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8B TR:P72368 FT (EMBL:U73374) (228 aa) fasta scores: E(): 3.8e-77, 96.491% FT id in 228 aa, and to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5B TR:P95696 FT (EMBL:U81973) (228 aa) fasta scores: E(): 1e-76, 95.614% FT id in 228 aa. Similar to SAR2744, 5.895% identity (56.140% FT ungapped) in 229 aa overlap" FT /product="capsular polysaccharide synthesis enzyme" FT CDS 170031..170795 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0153" FT /gene="capC" FT /note="Highly imilar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8C TR:P72369 FT (EMBL:U73374) (254 aa) fasta scores: E(): 1.5e-96, 99.213% FT id in 254 aa, and to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5C TR:P95697 FT (EMBL:U81973) (254 aa) fasta scores: E(): 4.2e-96, 98.425% FT id in 254 aa. Similar to SAR2743, 52.549% identity FT (53.175% ungapped) in 255 aa overlap" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 170343..170642 FT /note="Pfam match to entry PF02811 PHP_C, PHP domain FT C-terminal region, score 46.40, E-value 6.4e-10" FT /colour=9 FT CDS 170815..172638 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0154" FT /gene="capD" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5D TR:P95698 FT (EMBL:U81973) (607 aa) fasta scores: E(): 1.5e-214, FT 99.012% id in 607 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap8D TR:P72370 FT (EMBL:U73374) (607 aa) fasta scores: E(): 8.4e-214, FT 98.682% id in 607 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature join(170842..170910,170944..171000,171043..171111,171124..171192) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0154 by TMHMM2.0 at aa 10-32, 44-62, 77-99 and 104-126" FT misc_feature 171055..172611 FT /note="Pfam match to entry PF02719 Polysacc_synt_2, FT Polysaccharide biosynthesis protein, score 1243.80, FT E-value 0" FT /colour=9 FT CDS 172628..173656 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0155" FT /gene="capE" FT /note="Identical to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8E TR:P72371 FT (EMBL:U73374) (342 aa) fasta scores: E(): 4.3e-127, FT 100.000% id in 342 aa Highly similar to Staphylococcus FT aureus capsular polysaccharide synthesis enzyme Cap5E FT TR:P95699 (EMBL:U81973) (342 aa) fasta scores: E(): FT 1e-126, 99.708% id in 342 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 172628..173524 FT /note="Pfam match to entry PF02719 Polysacc_synt_2, FT Polysaccharide biosynthesis protein, score -255.90, FT E-value 2.4e-09" FT /colour=9 FT CDS 173669..174778 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0156" FT /gene="capF" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5F TR:P95700 FT (EMBL:U81973) (371 aa) fasta scores: E(): 3.6e-143, FT 99.187% id in 369 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap8F TR:P72372 FT (EMBL:U73374) (371 aa) fasta scores: E(): 4.6e-141, FT 97.832% id in 369 aa" FT /product="capsular polysaccharide synthesis enzyme" FT CDS 174782..175906 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0157" FT /gene="capG" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8G TR:P72373 FT (EMBL:U73374) (374 aa) fasta scores: E(): 2.2e-139, FT 99.465% id in 374 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap5G TR:P95701 FT (EMBL:U81973) (374 aa) fasta scores: E(): 9.9e-139, FT 99.198% id in 374 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 174914..175864 FT /note="Pfam match to entry PF02350 Epimerase_2, FT UDP-N-acetylglucosamine 2-epimerase, score 604.50, E-value FT 6.2e-178" FT /colour=9 FT CDS 175909..176988 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0158" FT /gene="cap8H" FT /note="Similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8H TR:P72374 FT (EMBL:U73374) (359 aa) fasta scores: E(): 2.4e-129, FT 93.872% id in 359 aa, and to Streptococcus pneumoniae FT capsular polysaccharide synthesis enzyme O-antigen FT translocase WciK TR:Q9AHC9 (EMBL:AF316639) (358 aa) fasta FT scores: E(): 5.2e-26, 31.319% id in 364 aa" FT /product="capsular polysaccharide synthesis enzyme" FT CDS 176981..178375 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0159" FT /gene="cap8I" FT /note="Poor database matches. Similar to Staphylococcus FT aureus capsular polysaccharide synthesis enzyme Cap8I FT TR:P72375 (EMBL:U73374) (464 aa) fasta scores: E(): FT 2e-161, 98.060% id in 464 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature join(176993..177046,177059..177112,177146..177205,177248..177316,177353..177421,177500..177568,177602..177661,177671..177724,177743..177799,178106..178174,178211..178264,178274..178342) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0159 by TMHMM2.0 at aa 5-22, 27-44, 56-75, 90-112, FT 125-147, 174-196, 208-227, 231-248, 255-273, 376-398, FT 411-428 and 432-454" FT CDS 178372..178929 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0160" FT /gene="cap8J" FT /note="Identical to aureus capsular polysaccharide FT synthesis enzyme Cap8J TR:P72376 (EMBL:U73374) (185 aa) FT fasta scores: E(): 7.2e-73, 100.000% id in 185 aa. FT C_terminal region is similar to the C-terminus of Vibrio FT cholerae probable galactoside-O-acetyl transferase WblB FT TR:O87158 (EMBL:AB012957) (161 aa) fasta scores: E(): FT 4.6e-10, 38.333% id in 120 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 178660..178713 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 8.30, FT E-value 68" FT /colour=9 FT misc_feature 178759..178812 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 11.20, FT E-value 24" FT /colour=9 FT misc_feature 178813..178866 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 11.80, FT E-value 16" FT /colour=9 FT CDS 178938..180176 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0161" FT /gene="cap8K" FT /note="Similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8K TR:P72377 FT (EMBL:U73374) (412 aa) fasta scores: E(): 2.9e-128, FT 97.573% id in 412 aa, and to Pseudomonas aeruginosa FT protein O-antigen translocase WbpF TR:P72137 (EMBL:U50396) FT (411 aa) fasta scores: E(): 3.5e-19, 22.850% id in 407 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 178953..179756 FT /note="Pfam match to entry PF01943 Polysacc_synt, FT Polysaccharide biosynthesis protein, score 17.40, E-value FT 0.00051" FT /colour=9 FT misc_feature join(178974..179042,179070..179138,179175..179243,179253..179321,179358..179426,179436..179495,179586..179645,179655..179723,179784..179852,179895..179963,179997..180050,180078..180146) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0161 by TMHMM2.0 at aa 13-35, 45-67, 80-102, 106-128, FT 141-163, 167-186, 217-236, 240-262, 283-305, 320-342, FT 354-371 and 381-403" FT CDS 180210..181415 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0162" FT /gene="capL" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5L TR:P95705 FT (EMBL:U81973) (401 aa) fasta scores: E(): 1.5e-152, FT 99.501% id in 401 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap8L TR:P72378 FT (EMBL:U73374) (401 aa) fasta scores: E(): 8.6e-151, FT 98.005% id in 401 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 180840..181148 FT /note="Pfam match to entry PF00534 Glycos_transf_1, FT Glycosyl transferases group 1, score 24.30, E-value FT 1.7e-05" FT /colour=9 FT CDS 181426..181983 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0163" FT /gene="capM" FT /note="Similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5M TR:P95706 FT (EMBL:U81973) (185 aa) fasta scores: E(): 4.5e-69, 99.459% FT id in 185 aa, and to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8M TR:P72379 FT (EMBL:U73374) (185 aa) fasta scores: E(): 6.1e-69, 98.378% FT id in 185 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 181429..181977 FT /note="Pfam match to entry PF02397 Bact_transf, Bacterial FT sugar transferase, score 143.70, E-value 3.3e-39" FT /colour=9 FT misc_feature 181444..181509 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0163 by TMHMM2.0 at aa 7-28" FT CDS 181983..182870 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0164" FT /gene="capN" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5N TR:P95707 FT (EMBL:U81973) (295 aa) fasta scores: E(): 1.7e-110, FT 98.644% id in 295 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap8N TR:P72380 FT (EMBL:U73374) (295 aa) fasta scores: E(): 1.4e-109, FT 97.966% id in 295 aa" FT /product="capsular polysaccharide synthesis enzyme" FT CDS 182924..184186 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0165" FT /gene="capO" FT /note="Highly imilar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap5O TR:P95708 FT (EMBL:U81973) (420 aa) fasta scores: E(): 3.9e-157, FT 99.048% id in 420 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap8O TR:P72381 FT (EMBL:U73374) (420 aa) fasta scores: E(): 1.6e-156, FT 99.048% id in 420 aa" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 182924..184126 FT /note="Pfam match to entry PF00984 UDPG_MGDP_dh, FT UDP-glucose/GDP-mannose dehydrogenase family, score FT 656.30, E-value 1.5e-193" FT /colour=9 FT CDS 184233..185408 FT /class="4.1.4" FT /colour=3 FT /locus_tag="SAR0166" FT /gene="capP" FT /note="Highly similar to Staphylococcus aureus capsular FT polysaccharide synthesis enzyme Cap8P TR:P72382 FT (EMBL:U73374) (391 aa) fasta scores: E(): 2.4e-146, FT 98.721% id in 391 aa, and to Staphylococcus aureus FT capsular polysaccharide synthesis enzyme Cap5P TR:P95709 FT (EMBL:U81973) (391 aa) fasta scores: E(): 2.8e-146, FT 98.465% id in 391 aa. Similar to SAR2199, 60.372% identity FT (60.372% ungapped) in 376 aa overlap" FT /product="capsular polysaccharide synthesis enzyme" FT misc_feature 184389..185348 FT /note="Pfam match to entry PF02350 Epimerase_2, FT UDP-N-acetylglucosamine 2-epimerase, score 710.30, E-value FT 9.2e-210" FT /colour=9 FT CDS complement(185473..185799) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0167" FT /note="Similar to Aeropyrum pernix hypothetical protein FT APE1333 TR:Q9YCC3 (EMBL:AP000061) (103 aa) fasta scores: FT E(): 3.8e-05, 35.802% id in 81 aa, and to Bacillus FT subtilis hypothetical protein YetG TR:O31534 (EMBL:Z99107) FT (125 aa) fasta scores: E(): 0.00029, 31.395% id in 86 aa. FT Similar to SAR1109, 63.551% identity (64.762% ungapped) in FT 107 aa overlap" FT /product="conserved hypothetical protein" FT CDS complement(185806..186189) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0168" FT /note="Similar to Staphylococcus carnosus hypothetical FT protein TR:Q9F328 (EMBL:AJ279090) (129 aa) fasta scores: FT E(): 4.4e-25, 55.118% id in 127 aa, and to Pasteurella FT multocida hypothetical protein PM0679 TR:Q9CMX2 FT (EMBL:AE006104) (120 aa) fasta scores: E(): 1.2e-11, FT 33.333% id in 120 aa" FT /product="putative membrane protein" FT misc_feature complement(join(185845..185898,185911..185964,186076..186180)) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0168 by TMHMM2.0 at aa 4-38, 76-93 and 98-115" FT misc_feature complement(186094..186189) FT /note="Signal peptide predicted for SAR0168 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.977) with cleavage site FT probability 0.348 between residues 32 and 33" FT /colour=6 FT CDS 186616..188103 FT /class="3.4.3" FT /colour=6 FT /locus_tag="SAR0169" FT /note="Similar to Vibrio cholerae aldehyde dehydrogenase FT AldA SW:DHAL_VIBCH (P23240) (506 aa) fasta scores: E(): FT 7.5e-81, 44.490% id in 490 aa, and to Alteromonas sp FT aldehyde dehydrogenase OlgA TR:O50609 (EMBL:AB009654) (505 FT aa) fasta scores: E(): 8.8e-78, 43.035% id in 481 aa" FT /product="putative aldehyde dehydrogenase" FT misc_feature 186673..188076 FT /note="Pfam match to entry PF00171 aldedh, Aldehyde FT dehydrogenase family, score 703.70, E-value 8.4e-208" FT /colour=9 FT misc_feature 187378..187401 FT /colour=8 FT /note="PS00687 Aldehyde dehydrogenases glutamic acid FT active site." FT misc_feature 187462..187497 FT /colour=8 FT /note="PS00070 Aldehyde dehydrogenases cysteine active FT site." FT CDS 188750..189709 FT /class="1.5.2" FT /colour=3 FT /locus_tag="SAR0170" FT /note="Similar to Alcaligenes sp cation efflux system FT protein CzcD SW:CZCD_ALCSP (P94178) (316 aa) fasta scores: FT E(): 6.7e-32, 36.458% id in 288 aa, and to Staphylococcus FT aureus zinc resistance protein CzrB TR:Q9ZNF5 FT (EMBL:AB016431) (325 aa) fasta scores: E(): 6.9e-38, FT 41.237% id in 291 aa" FT /product="putative cation efflux system protein" FT misc_feature join(188837..188905,188933..188992,189029..189097,189140..189208,189245..189313,189323..189376) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0170 by TMHMM2.0 at aa 30-52, 62-81, 94-116, 131-153, FT 166-188 and 192-209" FT misc_feature 188840..189676 FT /note="Pfam match to entry PF01545 Cation_efflux, Cation FT efflux family, score 310.00, E-value 2.8e-89" FT /colour=9 FT CDS complement(189771..189974) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0171" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 190154..190666 FT /class="0.0.0" FT /colour=10 FT /locus_tag="SAR0172" FT /note="Poor database matches. Similar to Synechococcus sp FT alpha-helical coiled-coil protein SrpF TR:Q9R6V4 FT (EMBL:AF176824) (175 aa) fasta scores: E(): 1.8e-21, FT 42.515% id in 167 aa" FT /product="conserved hypothetical protein" FT CDS 191008..191748 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0173" FT /note="Similar to Synechococcus sp nitrate transport FT ATP-binding protein NrtD SW:NRTD_SYNP7 (P38046) (274 aa) FT fasta scores: E(): 9.7e-28, 40.343% id in 233 aa, and to FT Phormidium laminosum ATP binding protein NrtC-Phl FT TR:Q51882 (EMBL:Z19598) (625 aa) fasta scores: E(): FT 7.4e-29, 43.154% id in 241 aa" FT /product="putative ABC transporter ATP-binding protein" FT misc_feature 191086..191607 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 183.30, E-value 4e-51" FT /colour=9 FT misc_feature 191107..191130 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 191762..192736 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0174" FT /note="Internal region of CDS is similar to internal FT regions of Escherichia coli taurine-binding periplasmic FT protein precursor TauA SW:TAUA_ECOLI (Q47537) (320 aa) FT fasta scores: E(): 0.2, 25.410% id in 244 aa, and FT Escherichia coli putative aliphatic sulfonates binding FT protein precursor SsuA SW:SSUA_ECOLI (P75853) (319 aa) FT fasta scores: E(): 0.00019, 22.509% id in 271 aa" FT /product="putative lipoprotein" FT misc_feature 191762..191836 FT /note="Signal peptide predicted for SAR0174 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.652) with cleavage site FT probability 0.583 between residues 25 and 26" FT /colour=6 FT misc_feature 191783..191815 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 192733..193494 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0175" FT /note="Similar to Escherichia coli taurine transport FT system permease protein TauC SW:TAUC_ECOLI (Q47539) (275 FT aa) fasta scores: E(): 5.2e-22, 29.084% id in 251 aa, and FT to Pseudomonas aeruginosa probable permease of ABC FT transporter PA3443 TR:Q9HYG3 (EMBL:AE004765) (262 aa) FT fasta scores: E(): 6.8e-28, 34.034% id in 238 aa" FT /product="putative transport system permease" FT misc_feature join(192757..192825,192835..192903,192922..192990,193078..193146,193270..193338,193396..193455) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0175 by TMHMM2.0 at aa 9-31, 35-57, 64-86, 116-138, FT 180-202 and 222-241" FT CDS 193507..194538 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0176" FT /note="Similar to Solanum tuberosum isovaleryl-CoA FT dehydrogenase precursor Ivd1 TR:Q9FS88 (EMBL:AJ278987) FT (412 aa) fasta scores: E(): 0.14, 19.805% id in 308 aa, FT and to Neisseria meningitidis acyl-CoA dehydrogenase FT family protein NMB0994 TR:Q9JZL9 (EMBL:AE002450) (363 aa) FT fasta scores: E(): 1.2e-22, 30.636% id in 346 aa" FT /product="conserved hypothetical protein" FT CDS 194752..195111 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0177" FT /note="Similar to Bacillus subtilis hypothetical protein FT YrhF SW:YRHF_BACSU (O05398) (122 aa) fasta scores: E(): FT 2.4e-11, 36.937% id in 111 aa. C-terminal region is FT similar to Bacillus halodurans hypothetical protein BH2529 FT TR:Q9K9W6 (EMBL:AP001515) (82 aa) fasta scores: E(): FT 2.1e-06, 44.000% id in 75 aa" FT /product="conserved hypothetical protein" FT CDS 195186..196310 FT /class="3.5.2" FT /colour=7 FT /locus_tag="SAR0178" FT /note="Similar to Solanum tuberosum mitochondrial formate FT dehydrogenase precursor Fdh SW:FDH_SOLTU (Q07511) (379 aa) FT fasta scores: E(): 3.8e-59, 47.550% id in 347 aa, and to FT Rhizobium meliloti probable NAD-dependent formate FT dehdyrogenase SMA0478 TR:AAK64909 (EMBL:AE007218) (401 aa) FT fasta scores: E(): 4.6e-54, 46.377% id in 345 aa" FT /product="putative D-isomer specific 2-hydroxyacid FT dehydrogenase" FT misc_feature 195321..195611 FT /note="Pfam match to entry PF00389 2-Hacid_DH, D-isomer FT specific 2-hydroxyacid dehydrogenase, catalytic domain, FT score 76.00, E-value 7.6e-19" FT /colour=9 FT misc_feature 195615..196160 FT /note="Pfam match to entry PF02826 2-Hacid_DH_C, D-isomer FT specific 2-hydroxyacid dehydrogenase, NAD binding domain, FT score 250.10, E-value 3.1e-71" FT /colour=9 FT misc_feature 195759..195842 FT /colour=8 FT /note="PS00065 D-isomer specific 2-hydroxyacid FT dehydrogenases NAD-binding signature." FT misc_feature 195894..195962 FT /colour=8 FT /note="PS00670 D-isomer specific 2-hydroxyacid FT dehydrogenases signature 2." FT CDS 196696..197946 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0179" FT /note="Similar to Lactococcus lactis proton motive FT force-dependent drug transporter LmrP TR:Q48658 FT (EMBL:X89779) (408 aa) fasta scores: E(): 2.4e-09, 24.096% FT id in 415 aa, and to Deinococcus radiodurans integral FT membrane protein LmrP TR:Q9RZS1 (EMBL:AE001826) (432 aa) FT fasta scores: E(): 2.2e-27, 27.094% id in 406 aa" FT /product="putative transporter protein" FT misc_feature join(196732..196791,196819..196887,196906..196965,196978..197037,197098..197166,197179..197247,197368..197436,197503..197571,197590..197643,197653..197721,197758..197826,197854..197922) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0179 by TMHMM2.0 at aa 13-32, 42-64, 71-90, 95-114, FT 135-157, 162-184, 225-247, 270-292, 299-316, 320-342, FT 355-377 and 387-409" FT CDS 198393..205568 FT /class="3.3.21" FT /colour=7 FT /locus_tag="SAR0180" FT /note="Similar to the N-terminal region of Bacillus FT licheniformis bacitracin synthetase 3 BacC SW:BACC_BACLI FT (O68008) (6359 aa) fasta scores: E(): 2.8e-147, 32.871% id FT in 2093 aa, and to Bacillus subtilis peptide synthetase FT PpsD TR:P94459 (EMBL:Z34883) (3603 aa) fasta scores: E(): FT 4.2e-166, 31.103% id in 2122 aa" FT /product="putative non-ribosomal peptide synthetase" FT misc_feature 199707..200885 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score 448.90, E-value 4.5e-131" FT /colour=9 FT misc_feature 200058..200093 FT /colour=8 FT /note="PS00455 Putative AMP-binding domain signature." FT misc_feature 201129..201323 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 70.70, E-value FT 6e-18" FT /colour=9 FT misc_feature 201198..201245 FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site." FT misc_feature 201369..202223 FT /note="Pfam match to entry PF00668 Condensation, FT Condensation domain, score 221.30, E-value 1.2e-62" FT /colour=9 FT misc_feature 202782..203969 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score 386.50, E-value 2.7e-112" FT /colour=9 FT misc_feature 204216..204407 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 50.50, E-value FT 2.4e-12" FT /colour=9 FT misc_feature 204285..204332 FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site." FT CDS 205581..206225 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0181" FT /note="N-terminus is similar to N-terminal regions of FT Bacillus subtilis lipopeptide antibiotics iturin A and FT surfactin biosynthesis protein Lpa-14 SW:LP14_BACSU FT (P39144) (224 aa) fasta scores: E(): 3e-07, 30.682% id in FT 176 aa, and Bacillus pumilus surfactin synthesis regulator FT Psf-1 SW:PSF1_BACPU (P55810) (233 aa) fasta scores: E(): FT 3.6e-07, 30.508% id in 177 aa" FT /product="4'-phosphopantetheinyl transferase superfamily FT protein" FT misc_feature 205896..206165 FT /note="Pfam match to entry PF01648 ACPS, FT 4'-phosphopantetheinyl transferase superfamily, score FT 4.00, E-value 0.03" FT /colour=9 FT CDS complement(206554..207048) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0182" FT /note="Similar to Lactococcus lactis hypothetical protein FT YreD TR:Q9CEZ2 (EMBL:AE006399) (178 aa) fasta scores: E(): FT 6.7e-30, 47.771% id in 157 aa, and to Campylobacter jejuni FT putative integral membrane protein CJ0014C TR:Q9PJ97 FT (EMBL:AL139074) (174 aa) fasta scores: E(): 8.7e-24, FT 42.424% id in 165 aa" FT /product="putative membrane protein" FT misc_feature complement(join(206575..206631,206674..206742,206776..206844,206962..207030)) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0182 by TMHMM2.0 at aa 7-29, 69-91, 103-125 and FT 140-158" FT CDS complement(207318..208088) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0183" FT /note="Similar to Bacillus stearothermophilus FT acetylglutamate kinase ArgB SW:ARGB_BACST (Q07905) (258 FT aa) fasta scores: E(): 1.8e-24, 35.294% id in 255 aa, and FT to Bacillus halodurans N-acetylglutamate FT 5-phosphotransferase ArgB TR:Q9K8V4 (EMBL:AP001517) (260 FT aa) fasta scores: E(): 3.7e-27, 36.328% id in 256 aa" FT /product="putative amino acid kinase" FT misc_feature complement(207396..208085) FT /note="Pfam match to entry PF00696 aakinase, Amino acid FT kinase family, score 103.30, E-value 4.7e-27" FT /colour=9 FT CDS complement(208104..209345) FT /class="3.1.02" FT /colour=7 FT /locus_tag="SAR0184" FT /gene="argJ" FT /note="Similar to Bacillus stearothermophilus arginine FT biosynthesis bifunctional protein ArgJ [includes: FT glutamate N-acetyltransferase and amino-acid FT acetyltransferase] ArgJ SW:ARGJ_BACST (Q07908) (410 aa) FT fasta scores: E(): 5.4e-75, 52.451% id in 408 aa, and to FT Bacillus subtilis arginine biosynthesis bifunctional FT protein ArgJ [includes: glutamate N-acetyltransferase and FT amino-acid acetyltransferase] ArgJ SW:ARGJ_BACSU (P36843) FT (406 aa) fasta scores: E(): 4.6e-72, 52.750% id in 400 aa" FT /product="putative arginine biosynthesis bifunctional FT protein" FT misc_feature complement(208107..209267) FT /note="Pfam match to entry PF01960 ArgJ, ArgJ family, FT score 652.00, E-value 3.1e-192" FT /colour=9 FT CDS complement(209357..210391) FT /class="3.1.02" FT /colour=7 FT /locus_tag="SAR0185" FT /gene="argC" FT /note="Similar to Bacillus subtilis FT N-acetyl-gamma-glutamyl-phosphate reductase ArgC FT SW:ARGC_BACSU (P23715) (346 aa) fasta scores: E(): FT 1.1e-56, 45.087% id in 346 aa, and to Bacillus halodurans FT N-acetylglutamate gamma-semialdehyde dehydrogenase ArgC FT TR:Q9K8V2 (EMBL:AP001517) (345 aa) fasta scores: E(): FT 1.7e-58, 47.826% id in 345 aa" FT /product="putative N-acetyl-gamma-glutamyl-phosphate FT reductase" FT misc_feature complement(209447..209935) FT /note="Pfam match to entry PF02774 Semialdhyde_dhC, FT Semialdehyde dehydrogenase, dimerisation domain, score FT 160.80, E-value 2.3e-44" FT /colour=9 FT misc_feature complement(209915..209965) FT /colour=8 FT /note="PS01224 N-acetyl-gamma-glutamyl-phosphate reductase FT active site." FT misc_feature complement(209960..210388) FT /note="Pfam match to entry PF01118 Semialdhyde_dh, FT Semialdehyde dehydrogenase, NAD binding domain, score FT 91.60, E-value 1.6e-28" FT /colour=9 FT CDS complement(210427..211611) FT /class="3.4.2" FT /colour=6 FT /locus_tag="SAR0186" FT /note="Similar to the C-terminal region of Rattus FT norvegicus ornithine aminotransferase precursor protein FT Oat SW:OAT_RAT (P04182) (439 aa) fasta scores: E(): 1e-68, FT 46.770% id in 387 aa, and to Bacillus subtilis ornithine FT aminotransferase RocD SW:OAT_BACSU (P38021) (401 aa) fasta FT scores: E(): 4.6e-84, 51.151% id in 391 aa. Similar to FT SAR0919, 57.179% identity (57.179% ungapped) in 390 aa FT overlap" FT /product="putative ornithine aminotransferase precursor" FT misc_feature complement(210430..211584) FT /note="Pfam match to entry PF00202 aminotran_3, FT Aminotransferase class-III, score 569.90, E-value FT 8.5e-171" FT /colour=9 FT misc_feature complement(210841..210954) FT /colour=8 FT /note="PS00600 Aminotransferases class-III FT pyridoxal-phosphate attachment site." FT CDS complement(211864..213219) FT /class="1.5.1" FT /colour=3 FT /locus_tag="SAR0187" FT /note="Similar to Lactobacillus delbrueckii branched-chain FT amino acid transport system carrier protein BrnQ FT SW:BRNQ_LACDL (P54104) (446 aa) fasta scores: E(): FT 1.5e-65, 46.347% id in 438 aa, and to Bacillus subtilis FT branched-chain amino acid transport system carrier protein FT BrnQ SW:BRNQ_BACSU (P94499) (440 aa) fasta scores: E(): FT 4.7e-62, 44.196% id in 448 aa" FT /product="putative branched-chain amino acid transport FT system carrier protein" FT misc_feature complement(join(211897..211956,212050..212103,212122..212190,212200..212268,212329..212397,212440..212508,212569..212637,212695..212763,212800..212859,212902..212970,213031..213099,213127..213186)) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0187 by TMHMM2.0 at aa 12-31, 41-63, 84-106, 121-140, FT 153-175, 195-217, 238-260, 275-297, 318-340, 344-366, FT 373-390 and 422-441" FT misc_feature complement(213112..213219) FT /note="Signal peptide predicted for SAR0187 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.721 between residues 36 and 37" FT /colour=6 FT CDS complement(213486..214043) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0188" FT /note="Similar to Bacillus subtilis hypothetical protein FT YwoC TR:P94573 (EMBL:Z82987) (189 aa) fasta scores: E(): FT 1.5e-29, 48.649% id in 185 aa, and to Escherichia coli FT hypothetical protein YecD SW:YECD_ECOLI (P37347) (199 aa) FT fasta scores: E(): 1.5e-20, 40.541% id in 185 aa" FT /product="putative isochorismatase" FT misc_feature complement(213498..214040) FT /note="Pfam match to entry PF00857 Isochorismatase, FT Isochorismatase family, score 157.40, E-value 2.5e-43" FT /colour=9 FT CDS complement(214110..215750) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0189" FT /note="Similar to Enterobacter cloacae indole-3-pyruvate FT decarboxylase IpdC SW:DCIP_ENTCL (P23234) (552 aa) fasta FT scores: E(): 1.6e-73, 39.060% id in 553 aa, and to FT Pseudomonas putida indolepyruvate decarboxylase IpdC FT TR:Q9FDC2 (EMBL:AF285632) (546 aa) fasta scores: E(): FT 2.6e-74, 39.241% id in 553 aa" FT /product="putative thiamine pyrophosphate enzyme" FT misc_feature complement(214182..214700) FT /note="Pfam match to entry PF02775 TPP_enzymes_C, Thiamine FT pyrophosphate enzyme, C-terminal TPP binding domain, score FT 154.30, E-value 2.1e-42" FT /colour=9 FT misc_feature complement(214755..215183) FT /note="Pfam match to entry PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzyme, central domain, score 17.40, E-value FT 2e-05" FT /colour=9 FT misc_feature complement(215217..215750) FT /note="Pfam match to entry PF02776 TPP_enzymes_N, Thiamine FT pyrophosphate enzyme, N-terminal TPP binding domain, score FT 183.70, E-value 2.9e-51" FT /colour=9 FT CDS complement(216022..218067) FT /EC_number="2.7.1.69" FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0190" FT /gene="glcA" FT /note="Similar to Staphylococcus carnosus PTS system, FT glucose-specific IIABC component GlcA TR:Q57071 FT (EMBL:X93360) (675 aa) fasta scores: E(): 1.8e-187, FT 75.695% id in 683 aa, and to Bacillus halodurans PTS FT system, glucose-specific enzyme II, A component BH0844 FT TR:Q9KEK8 (EMBL:AP001510) (675 aa) fasta scores: E(): FT 1.8e-144, 59.647% id in 679 aa. Similar to SAR2618, FT 59.584% identity (61.692% ungapped) in 673 aa overlap" FT /product="glucose-specific PTS transporter protein, IIABC FT component" FT misc_feature complement(216103..216417) FT /note="Pfam match to entry PF00358 PTS_EIIA_1, FT phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 1, score 239.50, E-value 4.8e-68" FT /colour=9 FT misc_feature complement(216241..216279) FT /colour=8 FT /note="PS00371 PTS EIIA domains phosphorylation site FT signature 1." FT misc_feature complement(216682..216786) FT /note="Pfam match to entry PF00367 PTS_EIIB, FT phosphotransferase system, EIIB, score 65.80, E-value FT 1.8e-17" FT /colour=9 FT misc_feature complement(216697..216750) FT /colour=8 FT /note="PS01035 PTS EIIB domains cysteine phosphorylation FT site signature." FT misc_feature complement(join(216862..216930,216946..217005,217024..217092,217105..217161,217180..217236,217411..217479,217492..217560,217624..217692,217780..217848,217966..218034)) FT /colour=0 FT /note="10 probable transmembrane helices predicted for FT SAR0190 by TMHMM2.0 at aa 12-34, 74-96, 126-148, 170-192, FT 197-219, 278-296, 303-321, 326-348, 355-374 and 380-402" FT misc_feature complement(217036..218031) FT /note="Pfam match to entry PF02378 PTS_EIIC, FT Phosphotransferase system, EIIC, score 519.40, E-value FT 2.6e-152" FT /colour=9 FT misc_feature complement(217957..218067) FT /note="Signal peptide predicted for SAR0190 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.367 between residues 37 and 38" FT /colour=6 FT CDS 218652..219707 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0191" FT /note="Similar to Lactococcus lactis hypothetical protein FT YleB TR:Q9CGG7 (EMBL:AE006345) (353 aa) fasta scores: E(): FT 1.3e-32, 33.239% id in 355 aa, and to Bacillus halodurans FT hypothetical protein BH3573 TR:Q9K701 (EMBL:AP001519) (351 FT aa) fasta scores: E(): 2.9e-27, 31.534% id in 352 aa" FT /product="conserved hypothetical protein" FT CDS 219704..220603 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0192" FT /note="Similar to Lactococcus lactis hypothetical protein FT YleC TR:Q9CGG6 (EMBL:AE006345) (297 aa) fasta scores: E(): FT 5.4e-58, 57.439% id in 289 aa, and to Bacillus halodurans FT hypothetical protein BH3575 TR:Q9K6Z9 (EMBL:AP001519) (298 FT aa) fasta scores: E(): 9e-56, 54.698% id in 298 aa" FT /product="conserved hypothetical protein" FT misc_feature 219866..220342 FT /note="Pfam match to entry PF01380 SIS, SIS domain, score FT 5.80, E-value 0.03" FT /colour=9 FT misc_feature 220109..220132 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 220253..220306 FT /colour=8 FT /note="PS01272 Glucokinase regulatory protein family FT signature." FT CDS 220615..222069 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0193" FT /note="Similar to Salmonella typhimurium PTS system, FT sucrose-specific IIBC component ScrA SW:PTSB_SALTY FT (P08470) (456 aa) fasta scores: E(): 1e-28, 31.092% id in FT 476 aa, and to Lactococcus lactis sucrose-specific PTS FT system IIBC component YleD TR:Q9CGG5 (EMBL:AE006345) (454 FT aa) fasta scores: E(): 5.1e-88, 56.710% id in 462 aa" FT /product="sucrose-specific PTS tranporter protein" FT misc_feature 220636..220740 FT /note="Pfam match to entry PF00367 PTS_EIIB, FT phosphotransferase system, EIIB, score 57.60, E-value FT 4.4e-15" FT /colour=9 FT misc_feature 220672..220725 FT /colour=8 FT /note="PS01035 PTS EIIB domains cysteine phosphorylation FT site signature." FT misc_feature 221008..221862 FT /note="Pfam match to entry PF02378 PTS_EIIC, FT Phosphotransferase system, EIIC, score 139.90, E-value FT 4.7e-38" FT /colour=9 FT misc_feature join(221008..221076,221119..221187,221224..221292,221320..221379,221416..221484,221527..221595,221653..221721,221764..221817,221836..221904,221962..222030) FT /colour=0 FT /note="10 probable transmembrane helices predicted for FT SAR0193 by TMHMM2.0 at aa 132-154, 169-191, 204-226, FT 236-255, 268-290, 305-327, 347-369, 384-401, 408-430 and FT 450-472" FT CDS 222069..222947 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0194" FT /note="Similar to Lactococcus lactis transcription FT regulator YleF TR:Q9CGG3 (EMBL:AE006345) (283 aa) fasta FT scores: E(): 1.5e-26, 32.971% id in 276 aa, and to FT Thermotoga maritima hypothetical protein RpiR family FT transcriptional regulator TM0326 SW:Y326_THEMA (Q9WYG1) FT (280 aa) fasta scores: E(): 2.8e-19, 29.720% id in 286 aa. FT Similar to SAR2399, 54.639% identity (54.828% ungapped) in FT 291 aa overlap" FT /product="RpiR family transcriptional regulator" FT misc_feature 222075..222395 FT /note="Pfam match to entry PF01418 HTH_6, Helix-turn-helix FT domain, rpiR family, score 100.80, E-value 2.7e-26" FT /colour=9 FT misc_feature 222441..222851 FT /note="Pfam match to entry PF01380 SIS, SIS domain, score FT 47.00, E-value 4.2e-10" FT /colour=9 FT CDS complement(223142..223423) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0195" FT /note="Poor database matches, similar to an internal FT region of Schizolachnus pineti ATP synthase A chain FT subunit 6 Atp6 TR:Q9B6H4 (EMBL:AJ298678) (217 aa) fasta FT scores: E(): 2.1, 30.208% id in 96 aa. Doubtful CDS" FT /product="putative membrane protein" FT misc_feature complement(join(223163..223231,223268..223336,223364..223420)) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0195 by TMHMM2.0 at aa 2-20, 30-52 and 65-87" FT CDS 223636..226425 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0196" FT /note="Similar to Escherichia coli type I restriction FT enzyme EcoR124II R protein HsdR SW:T1R1_ECOLI (P10486) FT (1033 aa) fasta scores: E(): 3.2e-17, 35.119% id in 1008 FT aa, and to Helicobacter pylori type I restriction enzyme R FT protein HP0846 TR:O25517 (EMBL:AE000595) (866 aa) fasta FT scores: E(): 6.6e-77, 37.355% id in 862 aa" FT /product="putative type I restriction enzyme" FT CDS 226625..227488 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0197" FT /note="Previously sequenced as Staphylococcus aureus FT hypothetical 33.2 kDa protein TR:Q9RL83 (EMBL:Y18638) (280 FT aa) fasta scores: E(): 3.8e-98, 96.774% id in 279 aa. FT Internal region of the CDS is similar internal region of FT bacteriophage P4 cII protein SW:RCII_BPP4 (P13059) (264 FT aa) fasta scores: E(): 0.00028, 26.222% id in 225 aa" FT /product="hypothetical protein" FT misc_feature 226844..226891 FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site." FT CDS complement(227693..229285) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0198" FT /note="Similar to Rhizobium meliloti probable ABC FT transporter, ATP-binding protein SMA1434 TR:AAK65441 FT (EMBL:AE007265) (550 aa) fasta scores: E(): 3.9e-76, FT 44.318% id in 528 aa, and to Rhizobium loti peptide ABC FT transporter, ATP-binding protein MLL5490 TR:BAB51933 FT (EMBL:AP003006) (543 aa) fasta scores: E(): 6.8e-72, FT 43.289% id in 529 aa. Similar to SAR0951, 50.763% identity FT (50.763% ungapped) in 262 aa overlap" FT /product="ABC transporter ATP-binding protein" FT misc_feature complement(227792..228367) FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 217.80, E-value 1.7e-61" FT /colour=9 FT misc_feature complement(227978..228022) FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT misc_feature complement(228323..228346) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature complement(228590..229186) FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 209.30, E-value 5.8e-59" FT /colour=9 FT misc_feature complement(228776..228820) FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT misc_feature complement(229142..229165) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 229413..230720 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0199" FT /note="Possible alternative translational start sites. FT C-terminal region is similar to Bacillus subtilis FT dipeptide transport system permease protein DppB FT SW:DPPB_BACSU (P26903) (308 aa) fasta scores: E(): FT 8.1e-31, 32.993% id in 294 aa, and Bacillus halodurans FT oligopeptide ABC transporter BH0029 TR:Q9KGM9 FT (EMBL:AP001507) (314 aa) fasta scores: E(): 1.4e-36, FT 39.799% id in 299 aa" FT /product="putative transport system permease" FT misc_feature join(229431..229499,229719..229787,229815..229868,230073..230141,230178..230246,230289..230357,230463..230531,230613..230681) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0199 by TMHMM2.0 at aa 7-29, 103-125, 132-154, 221-243, FT 256-278, 293-315, 351-373 and 401-423" FT misc_feature 230370..230585 FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 25.40, E-value 0.0013" FT /colour=9 FT CDS 230726..231889 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0200" FT /note="C-terminal region is similar to Bacillus firmus FT dipeptide transport system permease protein DppC FT SW:DPPC_BACFI (P94312) (304 aa) fasta scores: E(): FT 9.3e-41, 40.071% id in 282 aa, and Bacillus halodurans FT oligopeptide ABC transporter BH0030 TR:Q9KGM8 FT (EMBL:AP001507) (301 aa) fasta scores: E(): 1.1e-42, FT 41.971% id in 274 aa. Possible alternative translational FT start sites" FT /product="putative transport system permease" FT misc_feature join(230768..230827,230846..230905,230948..231016,231098..231166,231302..231370,231407..231466,231476..231544,231656..231724,231782..231850) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0200 by TMHMM2.0 at aa 15-34, 41-60, 75-97, 125-147, FT 193-215, 228-247, 251-273, 311-333 and 353-375" FT misc_feature 231539..231769 FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 40.40, E-value 4.1e-08" FT /colour=9 FT CDS 231906..233681 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0201" FT /gene="rlp" FT /note="Previously sequenced as Staphylococcus aureus FT RGD-containing lipoprotein Rlp TR:Q9EY53 (EMBL:AY007316) FT (591 aa) fasta scores: E(): 2.8e-213, 99.831% id in 591 FT aa" FT /product="RGD-containing lipoprotein" FT misc_feature 231906..231986 FT /note="Signal peptide predicted for SAR0201 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.666 between residues 27 and 28" FT /colour=6 FT misc_feature 231930..231962 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 233719..235725 FT /class="3.2.15" FT /colour=7 FT /locus_tag="SAR0202" FT /note="Similar to Bacillus subtilis FT gamma-glutamyltranspeptidase precursor Ggt SW:GGT_BACSU FT (P54422) (587 aa) fasta scores: E(): 8.5e-75, 38.532% id FT in 545 aa, and to Escherichia coli FT gamma-glutamyltranspeptidase precursor Ggt SW:GGT_ECOLI FT (P18956) (580 aa) fasta scores: E(): 1.6e-57, 34.615% id FT in 546 aa. CDS is truncated at the N-terminus and extended FT at the C-terminus in comparison to the B. subtilis and E. FT coli proteins" FT /product="putative gamma-glutamyltranspeptidase" FT misc_feature 233806..235341 FT /note="Pfam match to entry PF01019 G_glu_transpept, FT Gamma-glutamyltranspeptidase, score 550.40, E-value FT 1.3e-161" FT /colour=9 FT CDS complement(236262..236888) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0203" FT /note="Similar to Escherichia coli acyl carrier protein FT phosphodiesterase AcpD SW:ACPD_ECOLI (P41407) (200 aa) FT fasta scores: E(): 4.6e-13, 32.530% id in 166 aa, and to FT Bacillus stearothermophilus NAD(P)H dehydrogenase Di1 FT TR:Q9X4K2 (EMBL:AF112858) (211 aa) fasta scores: E(): FT 1.4e-52, 62.559% id in 211 aa" FT /product="putative phosphodiesterase" FT misc_feature complement(236526..236549) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 237097..237675 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0204" FT /note="No significant database matches to the full length FT CDS. C-terminus is similar to the C-terminal regions of FT Staphylococcus aureus peptidoglycan hydrolase LytM FT TR:O33599 (EMBL:L77194) (322 aa) fasta scores: E(): FT 1.3e-17, 41.791% id in 134 aa, and to Staphylococcus FT simulans lysostaphin precursor Lss SW:LSTP_STASI (P10547) FT (493 aa) fasta scores: E(): 4e-17, 40.789% id in 152 aa" FT /product="putative peptidase" FT misc_feature 237097..237168 FT /note="Signal peptide predicted for SAR0204 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.938) with cleavage site FT probability 0.645 between residues 24 and 25" FT /colour=6 FT misc_feature 237115..237171 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0204 by TMHMM2.0 at aa 7-25" FT misc_feature 237364..237630 FT /note="Pfam match to entry PF01551 Peptidase_M37, FT Peptidase family M23/M37, score 96.10, E-value 7e-25" FT /colour=9 FT CDS 238058..239155 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0205" FT /note="Similar to Thermococcus litoralis maltose transport FT protein MalK TR:Q9YGA6 (EMBL:AF121946) (372 aa) fasta FT scores: E(): 1.4e-60, 52.279% id in 373 aa, and to FT Bacillus subtilis probable multiple sugar-binding FT transport ATP-binding protein MsmX SW:MSMX_BACSU (P94360) FT (365 aa) fasta scores: E(): 1.8e-82, 65.479% id in 365 aa" FT /product="putative ABC transporter, ATP-binding protein" FT misc_feature 238145..238690 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 220.80, E-value 2e-62" FT /colour=9 FT misc_feature 238166..238189 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 238460..238504 FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT CDS 239168..240439 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0206" FT /note="Similar to Streptococcus pneumoniae FT maltose/maltodextrin-binding protein precursor MalX FT SW:MALX_STRPN (P29850) (423 aa) fasta scores: E(): FT 1.8e-28, 29.535% id in 430 aa, and to Bacillus halodurans FT maltose/maltodextrin-binding protein BH2926 TR:Q9K8S7 FT (EMBL:AP001517) (429 aa) fasta scores: E(): 4e-61, 40.610% FT id in 426 aa" FT /product="putative extracellular sugar-binding FT lipoprotein" FT misc_feature 239168..239251 FT /note="Signal peptide predicted for SAR0206 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.962 between residues 28 and 29" FT /colour=6 FT misc_feature 239198..239230 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT misc_feature 239318..240367 FT /note="Pfam match to entry PF01547 SBP_bacterial_1, FT Bacterial extracellular solute-binding protein, score FT 182.70, E-value 5.8e-51" FT /colour=9 FT CDS 240442..241710 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0207" FT /note="Similar to Streptococcus pneumoniae maltodextrin FT transport system permease protein MalC SW:MALC_STRPN FT (Q04698) (430 aa) fasta scores: E(): 3.1e-69, 44.860% id FT in 428 aa, and to Bacillus halodurans maltose/maltodextrin FT transport system permease protein BH2925 TR:Q9K8S8 FT (EMBL:AP001517) (430 aa) fasta scores: E(): 2.4e-113, FT 66.986% id in 418 aa" FT /product="putative sugar transport system permease" FT misc_feature join(240532..240600,240643..240711,240805..240873,241015..241083,241120..241188,241276..241344,241417..241476,241603..241671) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0207 by TMHMM2.0 at aa 31-53, 68-90, 122-144, 192-214, FT 227-249, 279-301, 326-345 and 388-410" FT misc_feature 241339..241578 FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 53.00, E-value 6.6e-12" FT /colour=9 FT misc_feature 241342..241428 FT /colour=8 FT /note="PS00402 Binding-protein-dependent transport systems FT inner membrane comp. sign." FT CDS 241712..242551 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0208" FT /note="Similar to Streptococcus pneumoniae maltodextrin FT transport system permease protein MalD SW:MALD_STRPN FT (Q04699) (277 aa) fasta scores: E(): 1.9e-37, 44.569% id FT in 267 aa, and to Bacillus halodurans maltose/maltodextrin FT transport system permease protein BH2924 TR:Q9K8S9 FT (EMBL:AP001517) (280 aa) fasta scores: E(): 3.6e-76, FT 72.857% id in 280 aa" FT /product="putative sugar transport system permease" FT misc_feature 241712..241843 FT /note="Signal peptide predicted for SAR0208 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.806) with cleavage site FT probability 0.559 between residues 44 and 45" FT /colour=6 FT misc_feature join(241745..241813,241934..242002,242036..242104,242132..242200,242261..242329,242435..242503) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0208 by TMHMM2.0 at aa 12-34, 75-97, 109-131, 141-163, FT 184-206 and 242-264" FT misc_feature 242195..242419 FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 72.90, E-value 6.5e-18" FT /colour=9 FT misc_feature 242198..242284 FT /colour=8 FT /note="PS00402 Binding-protein-dependent transport systems FT inner membrane comp. sign." FT CDS 242725..243804 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0209" FT /note="Similar to an internal region of Zymomonas mobilis FT glucose--fructose oxidoreductase Gfo SW:GFO_ZYMMO (Q07982) FT (439 aa) fasta scores: E(): 5.2e-17, 28.652% id in 356 aa. FT Full CDS is similar to Listeria monocytogenes FT NADH-dependent dehydrogenase homologue LapC TR:O52495 FT (EMBL:AF039207) (358 aa) fasta scores: E(): 7.8e-100, FT 67.507% id in 357 aa" FT /product="putative oxidoreductase" FT misc_feature 242734..243102 FT /note="Pfam match to entry PF01408 GFO_IDH_MocA, FT Oxidoreductase family, NAD-binding Rossmann fold, score FT 147.60, E-value 2.2e-40" FT /colour=9 FT misc_feature 243139..243471 FT /note="Pfam match to entry PF02894 GFO_IDH_MocA_C, FT Oxidoreductase family, C-terminal alpha/beta domain, score FT 10.60, E-value 0.12" FT /colour=9 FT CDS 243829..244869 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0210" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH2165 TR:Q9KAX1 (EMBL:AP001514) (348 aa) fasta scores: FT E(): 2.1e-51, 41.040% id in 346 aa, and to Listeria FT monocytogenes NADH-dependent dehydrogenase homologue LapC FT TR:O52495 (EMBL:AF039207) (358 aa) fasta scores: E(): FT 1.2e-38, 38.873% id in 355 aa" FT /product="putative oxidoreductase" FT misc_feature 243838..244197 FT /note="Pfam match to entry PF01408 GFO_IDH_MocA, FT Oxidoreductase family, NAD-binding Rossmann fold, score FT 142.50, E-value 7.3e-39" FT /colour=9 FT misc_feature 244231..244611 FT /note="Pfam match to entry PF02894 GFO_IDH_MocA_C, FT Oxidoreductase family, C-terminal alpha/beta domain, score FT 28.90, E-value 0.00011" FT /colour=9 FT CDS 244924..245892 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0211" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH1249 TR:Q9KDG4 (EMBL:AP001511) (322 aa) fasta scores: FT E(): 1.2e-81, 58.385% id in 322 aa, and to Bacillus FT subtilis hypothetical protein YfiH SW:YFIH_BACSU (P54724) FT (313 aa) fasta scores: E(): 1.7e-36, 39.130% id in 299 aa" FT /product="conserved hypothetical protein" FT CDS complement(246251..246745) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0212" FT /note="Similar to Pasteurella multocida hypothetical FT protein PM0984 TR:Q9CM58 (EMBL:AE006137) (172 aa) fasta FT scores: E(): 2.3e-24, 51.515% id in 165 aa, and to FT Haemophilus influenzae hypothetical protein HI0318 FT SW:Y318_HAEIN (P43984) (172 aa) fasta scores: E(): FT 4.1e-24, 52.381% id in 168 aa" FT /product="putative membrane protein" FT misc_feature complement(join(246287..246355,246485..246553,246566..246619)) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0212 by TMHMM2.0 at aa 43-60, 65-87 and 131-153" FT CDS 246978..248357 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0213" FT /gene="uhpT" FT /note="Similar to Escherichia coli hexose phosphate FT transport protein UhpT SW:UHPT_ECOLI (P13408) (463 aa) FT fasta scores: E(): 1.3e-81, 51.082% id in 462 aa, and to FT Pasteurella multocida putative hexose phosphate transport FT protein UhpT TR:Q9CL98 (EMBL:AE006172) (459 aa) fasta FT scores: E(): 1.6e-87, 53.896% id in 462 aa" FT /product="putative sugar phosphate transport protein" FT misc_feature join(247041..247109,247167..247235,247272..247340,247350..247418,247455..247517,247545..247613,247731..247799,247857..247925,247950..248009,248037..248105,248142..248201,248259..248327) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0213 by TMHMM2.0 at aa 22-44, 64-86, 99-121, 125-147, FT 160-180, 190-212, 252-274, 294-316, 325-344, 354-376, FT 389-408 and 428-450" FT misc_feature 247050..248324 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -133.20, E-value 0.047" FT /colour=9 FT misc_feature 247440..247490 FT /colour=8 FT /note="PS00942 glpT family of transporters signature." FT CDS complement(248716..249474) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0214" FT /note="Probable two-component regulatory system family, FT response regulator protein. Similar to Streptococcus FT pyogenes putative two-component response regulator SPY1062 FT TR:Q99ZU9 (EMBL:AE006550) (262 aa) fasta scores: E(): FT 1.2e-21, 34.568% id in 243 aa, and to Bacillus halodurans FT two-component response regulator BH3679 TR:Q9K6P9 FT (EMBL:AP001519) (257 aa) fasta scores: E(): 3.6e-13, FT 28.346% id in 254 aa" FT /product="putative response regulator" FT misc_feature complement(248722..248979) FT /note="Pfam match to entry PF00165 HTH_AraC, Bacterial FT regulatory helix-turn-helix proteins, araC family, score FT 64.40, E-value 2.4e-15" FT /colour=9 FT misc_feature complement(249109..249471) FT /note="Pfam match to entry PF00072 response_reg, Response FT regulator receiver domain, score 79.40, E-value 7.6e-20" FT /colour=9 FT CDS complement(249467..251023) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0215" FT /note="Probable two-component regulatory system family, FT sensor kinase protein. No significant database matches to FT the full length CDS. C-terminus is similar to the FT C-terminal regions of Streptococcus pyogenes putative FT two-component sensor histidine kinase SPY1061 TR:Q99ZV0 FT (EMBL:AE006550) (549 aa) fasta scores: E(): 2.2e-15, FT 25.978% id in 358 aa, and Bacillus halodurans FT two-component sensor histidine kinase BH3678 TR:Q9K6Q0 FT (EMBL:AP001519) (605 aa) fasta scores: E(): 4.2e-13, FT 25.915% id in 328 aa" FT /product="putative sensor kinase protein" FT misc_feature complement(249665..249796) FT /note="Pfam match to entry PF02518 HATPase_c, Histidine FT kinase-, DNA gyrase B-, phytochrome-like ATPase, score FT 20.80, E-value 0.00023" FT /colour=9 FT misc_feature complement(join(250292..250360,250913..250981)) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0215 by TMHMM2.0 at aa 15-37 and 222-244" FT misc_feature complement(250919..251023) FT /note="Signal peptide predicted for SAR0215 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.978) with cleavage site FT probability 0.496 between residues 35 and 36" FT /colour=6 FT CDS complement(251020..251988) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0216" FT /note="Similar to Treponema hyodysenteriae FT periplasmic-iron-binding protein BitA TR:Q9Z4R9 FT (EMBL:U75349) (336 aa) fasta scores: E(): 7.2e-24, 29.897% FT id in 291 aa, and to Streptococcus pyogenes putative FT periplasmic-iron-binding protein SPY1063 TR:Q99ZU8 FT (EMBL:AE006550) (323 aa) fasta scores: E(): 1.2e-20, FT 26.885% id in 305 aa" FT /product="putative lipoprotein" FT misc_feature complement(251917..251988) FT /note="Signal peptide predicted for SAR0216 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.997) with cleavage site FT probability 0.756 between residues 24 and 25" FT /colour=6 FT misc_feature complement(251935..251967) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 252576..254825 FT /EC_number="2.3.1.54" FT /class="3.5.1" FT /colour=1 FT /locus_tag="SAR0217" FT /note="Similar to Escherichia coli formate FT acetyltransferase 1 PflB SW:PFLB_ECOLI (P09373) (759 aa) FT fasta scores: E(): 1.4e-204, 66.227% id in 758 aa, and to FT Clostridium pasteurianum formate acetyltransferase Pfl FT SW:PFL_CLOPA (Q46266) (740 aa) fasta scores: E(): FT 3.5e-196, 65.041% id in 738 aa" FT /product="formate acetyltransferase" FT misc_feature 252603..254399 FT /note="Pfam match to entry PF02901 PFL, Pyruvate formate FT lyase, score 1147.30, E-value 0" FT /colour=9 FT misc_feature 254445..254768 FT /note="Pfam match to entry PF01228 Gly_radical, Glycine FT radical, score 169.50, E-value 5.7e-47" FT /colour=9 FT misc_feature 254730..254756 FT /colour=8 FT /note="PS00850 Glycine radical signature." FT CDS 254848..255603 FT /EC_number="1.97.1.4" FT /class="3.5.2" FT /colour=1 FT /locus_tag="SAR0218" FT /note="Similar to Streptococcus mutans pyruvate FT formate-lyase activating enzyme Act SW:PFLA_STRMU (O68575) FT (263 aa) fasta scores: E(): 5.3e-45, 50.000% id in 240 aa, FT and to Listeria monocytogenes pyruvate-formate lyase FT activating enzyme PflC TR:Q9X767 (EMBL:AJ009627) (248 aa) FT fasta scores: E(): 6.9e-51, 53.814% id in 236 aa" FT /product="putative pyruvate formate-lyase activating FT enzyme" FT misc_feature 254863..254958 FT /note="Pfam match to entry PF02143 Radical_activat, FT Radical activating enzyme, score 50.40, E-value 4e-11" FT /colour=9 FT misc_feature 254896..254961 FT /colour=8 FT /note="PS01087 Radical activating enzymes signature." FT misc_feature 254944..254961 FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signature." FT CDS 255707..255874 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0219" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 255925..257688 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0220" FT /note="Similar to Streptococcus pyogenes putative FT glycerophosphodiester phosphodiesterase SPY0839 TR:Q9A0C2 FT (EMBL:AE006534) (577 aa) fasta scores: E(): 1.2e-39, FT 35.233% id in 579 aa, and to Lactococcus lactis FT hypothetical protein YuhH TR:Q9CE50 (EMBL:AE006429) (617 FT aa) fasta scores: E(): 5.4e-37, 27.005% id in 611 aa" FT /product="putative membrane protein" FT misc_feature join(255985..256053,256132..256227,256288..256356,256444..256512,256591..256659,256687..256746,256858..256926) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0220 by TMHMM2.0 at aa 21-43, 70-101, 122-144, 174-196, FT 223-245, 255-274 and 312-334" FT CDS complement(257852..258196) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0221" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 258386..260215 FT /class="4.1.7" FT /colour=0 FT /locus_tag="SAR0222" FT /note="Similar to Staphylococcus aureus staphylocoagulase FT precursor SW:STC1_STAAU (P07767) (658 aa) fasta scores: FT E(): 2.3e-144, 73.520% id in 608 aa, and to Staphylococcus FT aureus staphylocoagulase precursor SW:STC2_STAAU (P17855) FT (715 aa) fasta scores: E(): 2.3e-141, 72.250% id in 609 FT aa. Contains a C-terminal imperfect repeat FT (ARPTQNKPSETNAYNVTTHANGQVSYG x4). CDS contains less amino FT acid residues at the C-terminus in comparison to other FT orthologues" FT /product="staphylocoagulase precursor" FT misc_feature 258386..258463 FT /note="Signal peptide predicted for SAR0222 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.978 between residues 26 and 27" FT /colour=6 FT misc_feature 259874..259954 FT /colour=8 FT /note="PS00429 Staphylocoagulase repeat signature." FT misc_feature 259955..260035 FT /colour=8 FT /note="PS00429 Staphylocoagulase repeat signature." FT misc_feature 260036..260116 FT /colour=8 FT /note="PS00429 Staphylocoagulase repeat signature." FT misc_feature 260117..260197 FT /colour=8 FT /note="PS00429 Staphylocoagulase repeat signature." FT CDS complement(260802..261986) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0223" FT /gene="fadA" FT /note="Similar to Brassica napus glyoxysomal FT beta-ketoacyl-thiolase TR:Q43742 (EMBL:X93015) (462 aa) FT fasta scores: E(): 2.8e-56, 46.173% id in 392 aa. FT Previously sequenced as Staphylococcus aureus putative FT 3-ketoacyl-CoA transferase FadA TR:AAK51158 FT (EMBL:AY033081) (397 aa) fasta scores: E(): 4.6e-142, FT 99.239% id in 394 aa" FT /product="putative thiolase" FT misc_feature complement(260808..260876) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0223 by TMHMM2.0 at aa 371-393" FT misc_feature complement(260811..261188) FT /note="Pfam match to entry PF02803 thiolase_C, Thiolase, FT C-terminal domain, score 223.30, E-value 3.6e-63" FT /colour=9 FT misc_feature complement(260826..260867) FT /colour=8 FT /note="PS00099 Thiolases active site." FT misc_feature complement(260925..260975) FT /colour=8 FT /note="PS00737 Thiolases signature 2." FT misc_feature complement(261198..261986) FT /note="Pfam match to entry PF00108 thiolase, Thiolase, FT N-terminal domain, score 314.50, E-value 1.2e-90" FT /colour=9 FT misc_feature complement(261669..261725) FT /colour=8 FT /note="PS00098 Thiolases acyl-enzyme intermediate FT signature." FT CDS complement(262016..264277) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0224" FT /gene="fadB" FT /note="N-terminal region is similar to Mus musculus short FT chain 3-hydroxyacyl-CoA dehydrogenase precursor HadH FT SW:HCDH_MOUSE (Q61425) (314 aa) fasta scores: E(): 3e-21, FT 33.333% id in 294 aa. Previously sequenced as FT Staphylococcus aureus putative 3-hydroxyacyl-CoA FT dehydrogenase FadB TR:AAK51157 (EMBL:AY033081) (753 aa) FT fasta scores: E(): 0, 98.672% id in 753 aa" FT /product="putative fatty oxidation complex protein" FT misc_feature complement(262379..262930) FT /note="Pfam match to entry PF00378 ECH, Enoyl-CoA FT hydratase/isomerase family, score 23.10, E-value 6.8e-09" FT /colour=9 FT misc_feature complement(262607..262669) FT /colour=8 FT /note="PS00166 Enoyl-CoA hydratase/isomerase signature." FT misc_feature complement(263417..263713) FT /note="Pfam match to entry PF00725 3HCDH, FT 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain, score FT 35.10, E-value 1.4e-06" FT /colour=9 FT misc_feature complement(263717..264277) FT /note="Pfam match to entry PF02737 3HCDH_N, FT 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain, score FT 110.80, E-value 2.7e-29" FT /colour=9 FT CDS complement(264464..265675) FT /class="3.4.4" FT /colour=6 FT /locus_tag="SAR0225" FT /gene="fadD" FT /note="Similar to Mus musculus mitochondrial glutaryl-CoA FT dehydrogenase GcdH SW:GCDH_MOUSE (Q60759) (438 aa) fasta FT scores: E(): 1e-29, 32.659% id in 346 aa. Previously FT sequenced as Staphylococcus aureus putative acyl-CoA FT dehydrogenase FadD TR:AAK51156 (EMBL:AY033081) (418 aa) FT fasta scores: E(): 1e-154, 100.000% id in 403 aa" FT /product="putative acyl-CoA dehydrogenase" FT misc_feature complement(264485..264898) FT /note="Pfam match to entry PF00441 Acyl-CoA_dh, Acyl-CoA FT dehydrogenase, C-terminal domain, score 57.80, E-value FT 8.6e-15" FT /colour=9 FT misc_feature complement(265097..265243) FT /note="Pfam match to entry PF02770 Acyl-CoA_dh_M, Acyl-CoA FT dehydrogenase, middle domain, score 50.80, E-value FT 4.2e-13" FT /colour=9 FT misc_feature complement(265247..265387) FT /note="Pfam match to entry PF02771 Acyl-CoA_dh_N, Acyl-CoA FT dehydrogenase, N-terminal domain, score 19.30, E-value FT 0.00055" FT /colour=9 FT CDS complement(265787..267292) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0226" FT /gene="fadE" FT /note="Similar to Rhizobium leguminosarum malonyl CoA FT synthetase MatB TR:Q9ZIP5 (EMBL:AF117694) (504 aa) fasta FT scores: E(): 3.1e-38, 27.866% id in 506 aa. Previously FT sequenced as Staphylococcus aureus putative acyl-CoA FT synthetase FadE TR:AAK51155 (EMBL:AY033081) (501 aa) fasta FT scores: E(): 8.5e-198, 99.401% id in 501 aa" FT /product="putative acyl-CoA synthetase" FT misc_feature complement(266021..267208) FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score 391.30, E-value 9.6e-114" FT /colour=9 FT misc_feature complement(266795..266830) FT /colour=8 FT /note="PS00455 Putative AMP-binding domain signature." FT CDS complement(267318..268880) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0227" FT /gene="fadX" FT /note="Weakly similar to Homo sapiens mitochondrial FT succinyl-CoA:3-ketoacid-coenzyme A transferase SCOT FT SW:SCOT_HUMAN (P55809) (520 aa) fasta scores: E(): 2e-05, FT 21.681% id in 452 aa. Previously sequenced as FT Staphylococcus aureus putative acetyl-CoA/acetoacetyl-CoA FT transferase FadX TR:AAK51154 (EMBL:AY033081) (525 aa) FT fasta scores: E(): 2.2e-208, 98.654% id in 520 aa" FT /product="putative acetyl-CoA transferase" FT misc_feature complement(268155..268877) FT /note="Pfam match to entry PF01144 CoA_trans, Coenzyme A FT transferase, score 58.20, E-value 1.7e-13" FT /colour=9 FT CDS 269254..269925 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0228" FT /note="Similar to Synechocystis sp hypothetical protein FT SLR0541 TR:Q55488 (EMBL:D64006) (236 aa) fasta scores: FT E(): 6.7e-21, 34.615% id in 208 aa, and to Pseudomonas FT aeruginosa probable glutamine amidotransferase PA0531 FT TR:Q9I605 (EMBL:AE004489) (238 aa) fasta scores: E(): FT 1.7e-20, 33.476% id in 233 aa" FT /product="putative glutamine amidotransferase class-I" FT misc_feature 269278..269817 FT /note="Pfam match to entry PF00117 GATase, Glutamine FT amidotransferase class-I, score -18.40, E-value 0.00024" FT /colour=9 FT CDS 270148..271290 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0229" FT /note="No significant database matches to the full length FT CDS. C-terminal region is similar to similar to Pyrococcus FT abyssi hypothetical protein PAB0037 TR:Q9V2K2 FT (EMBL:AJ248283) (249 aa) fasta scores: E(): 5.7e-07, FT 28.384% id in 229 aa, and to Streptococcus pyogenes FT hypothetical protein SPY1366 TR:Q99Z72 (EMBL:AE006574) FT (269 aa) fasta scores: E(): 0.0023, 23.675% id in 283 aa. FT Possible alternative translational start sites" FT /product="putative membrane protein" FT misc_feature join(270466..270534,270547..270615,270652..270720,270763..270831,270850..270918,270961..271029,271090..271158,271171..271230) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0229 by TMHMM2.0 at aa 107-129, 134-156, 169-191, FT 206-228, 235-257, 272-294, 315-337 and 342-361" FT CDS complement(271601..273076) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0230" FT /note="Similar to Bacillus halodurans nickel ABC FT transporter BH1796 TR:Q9KBX8 (EMBL:AP001513) (528 aa) FT fasta scores: E(): 4.7e-23, 31.653% id in 496 aa, and to FT Agrobacterium radiobacter agropinic acid permease AgaA FT TR:O50260 (EMBL:AF242881) (509 aa) fasta scores: E(): FT 5.6e-16, 26.261% id in 476 aa" FT /product="putative extracellular solute-binding FT lipoprotein" FT misc_feature complement(271646..272680) FT /note="Pfam match to entry PF00496 SBP_bac_5, Bacterial FT extracellular solute-binding proteins, family 5, score FT 66.10, E-value 1.2e-17" FT /colour=9 FT misc_feature complement(272999..273076) FT /note="Signal peptide predicted for SAR0230 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.826 between residues 26 and 27" FT /colour=6 FT misc_feature complement(273020..273052) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS complement(273274..273630) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0231" FT /note="Similar to Streptomyces coelicolor hypothetical FT protein SC2H2.18 TR:Q9F3D7 (EMBL:AL450289) (119 aa) fasta FT scores: E(): 1.5e-16, 42.857% id in 119 aa, and to FT Rhizobium loti hypothetical protein MLL7394 TR:BAB53507 FT (EMBL:AP003011) (120 aa) fasta scores: E(): 1.5e-16, FT 48.305% id in 118 aa" FT /product="conserved hypothetical protein" FT CDS complement(273787..273960) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0232" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature complement(join(273808..273861,273889..273942)) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0232 by TMHMM2.0 at aa 7-24 and 34-51" FT CDS complement(273985..275130) FT /class="3.2.06" FT /colour=7 FT /locus_tag="SAR0233" FT /note="Similar to Bacillus subtilis flavohemoprotein Hmp FT SW:HMPA_BACSU (P49852) (399 aa) fasta scores: E(): FT 7.5e-41, 38.653% id in 401 aa, and to Vibrio FT parahaemolyticus flavohemoprotein Hmp SW:HMPA_VIBPA FT (P40609) (394 aa) fasta scores: E(): 2.3e-35, 34.596% id FT in 396 aa" FT /product="flavohemoprotein" FT misc_feature complement(274048..274362) FT /note="Pfam match to entry PF00175 NAD_binding, FT Oxidoreductase FAD/NAD-binding domain, score 1.70, E-value FT 0.0012" FT /colour=9 FT misc_feature complement(274372..274680) FT /note="Pfam match to entry PF00970 FAD_binding_6, FT Oxidoreductase FAD-binding domain, score 37.90, E-value FT 2.3e-07" FT /colour=9 FT misc_feature complement(274717..275130) FT /note="Pfam match to entry PF00042 globin, Globin, score FT 54.20, E-value 2.8e-14" FT /colour=9 FT CDS 275703..276656 FT /EC_number="1.1.1.27" FT /class="3.5.2" FT /colour=1 FT /locus_tag="SAR0234" FT /gene="ldh1" FT /note="Similar to Bacillus subtilis L-lactate FT dehydrogenase Ldh SW:LDH_BACSU (P13714) (320 aa) fasta FT scores: E(): 1.5e-73, 64.630% id in 311 aa, and to FT Bacillus stearothermophilus L-lactate dehydrogenase Ldh FT TR:Q9S0N0 (EMBL:AB033627) (317 aa) fasta scores: E(): FT 1.4e-77, 67.101% id in 307 aa. Similar to SAR2680, 59.223% FT identity (59.609% ungapped) in 309 aa overlap" FT /product="L-lactate dehydrogenase 1" FT misc_feature 275712..276143 FT /note="Pfam match to entry PF00056 ldh, lactate/malate FT dehydrogenase, NAD binding domain, score 249.80, E-value FT 3.7e-71" FT /colour=9 FT misc_feature 276147..276653 FT /note="Pfam match to entry PF02866 ldh_C, lactate/malate FT dehydrogenase, alpha/beta C-terminal domain, score 285.90, FT E-value 4.9e-82" FT /colour=9 FT misc_feature 276228..276248 FT /colour=8 FT /note="PS00064 L-lactate dehydrogenase active site." FT CDS complement(276977..278506) FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0235" FT /note="Similar to the N-terminal region of Bacillus FT subtilis PTS system, glucose-specific IIABC component PtsG FT SW:PTGA_BACSU (P20166) (699 aa) fasta scores: E(): FT 6.6e-88, 47.500% id in 520 aa. Full length CDS is similar FT to Borrelia burgdorferi PTS system, glucose-specific IIBC FT component BB0645 TR:O51590 (EMBL:AE001166) (514 aa) fasta FT scores: E(): 6.5e-124, 61.961% id in 510 aa" FT /product="putative PTS transport system, IIBC component" FT misc_feature complement(277100..277204) FT /note="Pfam match to entry PF00367 PTS_EIIB, FT phosphotransferase system, EIIB, score 52.40, E-value FT 1.4e-13" FT /colour=9 FT misc_feature complement(277115..277168) FT /colour=8 FT /note="PS01035 PTS EIIB domains cysteine phosphorylation FT site signature." FT misc_feature complement(join(277277..277345,277358..277426,277445..277513,277526..277582,277601..277669,277844..277912,277931..277999,278057..278125,278162..278230,278267..278335,278396..278464)) FT /colour=0 FT /note="11 probable transmembrane helices predicted for FT SAR0235 by TMHMM2.0 at aa 15-37, 58-80, 93-115, 128-150, FT 170-192, 199-221, 280-302, 309-327, 332-354, 361-383 and FT 388-410" FT misc_feature complement(277457..278473) FT /note="Pfam match to entry PF02378 PTS_EIIC, FT Phosphotransferase system, EIIC, score 502.80, E-value FT 2.5e-147" FT /colour=9 FT misc_feature complement(278378..278506) FT /note="Signal peptide predicted for SAR0235 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.998) with cleavage site FT probability 0.705 between residues 43 and 44" FT /colour=6 FT CDS 278870..279805 FT /class="3.3.17" FT /colour=7 FT /locus_tag="SAR0236" FT /note="Similar to Crithidia fasciculata inosine-uridine FT preferring nucleoside hydrolase IunH SW:IUNH_CRIFA FT (Q27546) (314 aa) fasta scores: E(): 4.5e-38, 37.954% id FT in 303 aa, and to Escherichia coli hypothetical protein FT YbeK SW:YBEK_ECOLI (P41409) (311 aa) fasta scores: E(): FT 1.7e-45, 45.367% id in 313 aa" FT /product="putative inosine-uridine preferring nucleoside FT hydrolase" FT misc_feature 278873..279802 FT /note="Pfam match to entry PF01156 IU_nuc_hydro, FT Inosine-uridine preferring nucleoside hydrolase, score FT 381.20, E-value 1e-110" FT /colour=9 FT misc_feature 278891..278923 FT /colour=8 FT /note="PS01247 Inosine-uridine preferring nucleoside FT hydrolase family signature." FT misc_feature 278999..279037 FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain." FT CDS 279841..279987 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0237" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS join(280143..281561,281565..282239) FT /class="7.0.0" FT /colour=11 FT /locus_tag="SAR0238" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH0193 TR:Q9KGB4 (EMBL:AP001507) (683 aa) fasta scores: FT E(): 9.6e-81, 37.010% id in 689 aa, and to Streptococcus FT pyogenes hypothetical protein SPY1952 TR:Q99XZ1 FT (EMBL:AE006618) (686 aa) fasta scores: E(): 2.5e-33, FT 24.286% id in 700 aa. Contains a nonsense mutation (opal) FT after codon 473" FT /product="putative PTS multi-domain regulator FT (pseudogene)" FT /pseudo FT misc_feature 280194..280259 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1056 FT (+2.78 SD) at aa 18-39, sequence IHGKELESIFGLSRRQLGYRIQ" FT misc_feature 281016..281309 FT /note="Pfam match to entry PF00874 BglG_antitermin, FT Transcriptional antiterminator bglG family, score 22.70, FT E-value 3.7e-05" FT /colour=9 FT misc_feature 281781..282206 FT /note="Pfam match to entry PF00359 PTS_EIIA_2, FT Phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 2, score -3.80, E-value 2.3e-05" FT /colour=9 FT CDS 282224..282691 FT /EC_number="2.7.1.69" FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0240" FT /note="Similar to Escherichia coli PTS system, FT galactitol-specific IIA component GatA SW:PTKA_ECOLI FT (P37187) (150 aa) fasta scores: E(): 3.9e-05, 28.986% id FT in 138 aa, and to Bacillus halodurans phosphotransferase FT system FruA TR:Q9Z9U3 (EMBL:AB011837) (160 aa) fasta FT scores: E(): 1.9e-17, 43.421% id in 152 aa" FT /product="putative PTS transport system, IIA component" FT misc_feature 282233..282676 FT /note="Pfam match to entry PF00359 PTS_EIIA_2, FT Phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 2, score 44.00, E-value 2.4e-09" FT /colour=9 FT CDS 282714..282992 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0241" FT /note="Similar to Escherichia coli PTS system, FT galactitol-specific IIB component GatB SW:PTKB_ECOLI FT (P37188) (94 aa) fasta scores: E(): 3.7e-09, 37.363% id in FT 91 aa, and to Bacillus halodurans PTS system, FT galactitol-specific enzyme IIB component GatB TR:Q9KGB5 FT (EMBL:AP001507) (94 aa) fasta scores: E(): 1.5e-24, FT 81.319% id in 91 aa" FT /product="putative PTS transport system, IIB component" FT misc_feature 282714..282791 FT /note="Signal peptide predicted for SAR0241 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.859) with cleavage site FT probability 0.422 between residues 26 and 27" FT /colour=6 FT CDS 283219..284478 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0242" FT /note="Similar to Escherichia coli PTS system, FT galactitol-specific IIC component GatC SW:PTKC_ECOLI FT (P37189) (451 aa) fasta scores: E(): 5.1e-68, 44.337% id FT in 415 aa, and to Bacillus halodurans PTS system FT galactitol-specific enzyme IIC component GatC TR:Q9Z9U2 FT (EMBL:AB011837) (419 aa) fasta scores: E(): 4.6e-121, FT 78.043% id in 419 aa" FT /product="putative PTS transport system, IIC component" FT misc_feature join(283246..283311,283330..283398,283492..283560,283621..283689,283747..283815,283876..283944,284125..284193,284206..284274,284287..284355) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0242 by TMHMM2.0 at aa 10-31, 38-60, 92-114, 135-157, FT 177-199, 220-242, 303-325, 330-352 and 357-379" FT CDS 284496..285551 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0243" FT /note="Similar to Bacillus subtilis sorbitol dehydrogenase FT GutB SW:DHSO_BACSU (Q06004) (352 aa) fasta scores: E(): FT 2.9e-30, 35.077% id in 325 aa, and to Bacillus halodurans FT sorbitol dehydrogenase GutB SW:DHSO_BACHD (Q9Z9U1) (343 FT aa) fasta scores: E(): 1.6e-83, 62.974% id in 343 aa" FT /product="putative zinc-binding dehydrogenase" FT misc_feature 284532..285518 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score 323.40, E-value 2.7e-93" FT /colour=9 FT misc_feature 284670..284714 FT /colour=8 FT /note="PS00059 Zinc-containing alcohol dehydrogenases FT signature." FT CDS 285553..285699 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0244" FT /note="Poor database matches. Similar to the C-terminal FT region of Bacillus halodurans hypothetical protein FT TR:Q9Z9U0 (EMBL:AB011837) (100 aa) fasta scores: E(): FT 5e-05, 47.727% id in 44 aa" FT /product="hypothetical protein" FT misc_feature 285607..285675 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0244 by TMHMM2.0 at aa 19-41" FT CDS 285723..286766 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0245" FT /note="Similar to Escherichia coli galactitol-1-phosphate FT 5-dehydrogenase GatD SW:GATD_ECOLI (P37190) (346 aa) fasta FT scores: E(): 3.7e-37, 36.452% id in 310 aa, and to FT Bacillus halodurans sorbitol dehydrogenase GutB TR:Q9KGB7 FT (EMBL:AP001507) (354 aa) fasta scores: E(): 4.1e-78, FT 56.936% id in 346 aa" FT /product="putative zinc-binding dehydrogenase" FT misc_feature 285753..286757 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score 296.00, E-value 4.5e-85" FT /colour=9 FT misc_feature 285894..285938 FT /colour=8 FT /note="PS00059 Zinc-containing alcohol dehydrogenases FT signature." FT CDS 287294..288010 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0246" FT /note="Similar to the N-terminal region of Haemophilus FT influenzae CDP-ribitol pyrophosphorylase TR:Q48154 FT (EMBL:Z37516) (474 aa) fasta scores: E(): 6e-21, 39.744% FT id in 234 aa. Full length CDS is similar to Pasteurella FT multocida 4-diphosphocytidyl-2C-methyl-D-erythritol FT synthase IspD SW:ISPD_PASMU (P57953) (238 aa) fasta FT scores: E(): 3.8e-14, 34.061% id in 229 aa. Similar to FT SAR0252, 76.471% identity (76.471% ungapped) in 238 aa FT overlap" FT /product="conserved hypothetical protein" FT misc_feature 287297..287992 FT /note="Pfam match to entry PF01128 UPF0007, FT Uncharacterized protein family UPF0007, score 93.70, FT E-value 3.6e-24" FT /colour=9 FT CDS 288003..289028 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0247" FT /note="Similar to Escherichia coli L-idonate FT 5-dehydrogenase IdnD SW:IDND_ECOLI (P39346) (343 aa) fasta FT scores: E(): 4.8e-05, 25.000% id in 308 aa, and to FT Thermoplasma volcanium alcohol dehydrogenase TVG0995648 FT TR:BAB60114 (EMBL:AP000994) (335 aa) fasta scores: E(): FT 1.2e-07, 25.581% id in 344 aa. Similar to SAR0253, 80.645% FT identity (80.645% ungapped) in 341 aa overlap" FT /product="putative zinc-binding dehydrogenase" FT misc_feature 288045..289019 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score 39.90, E-value 1.4e-09" FT /colour=9 FT CDS 289050..290744 FT /class="0.0.2" FT /colour=8 FT /locus_tag="SAR0248" FT /note="No significant database matches to the full length FT CDS. C-terminus is similar to the C-terminal regions of FT Staphylococcus epidermidis FT CDP-glycerol:poly(glycerolphosphate) FT glycerophosphotransferase TagF TR:Q9RPD1 (EMBL:AF162863) FT (721 aa) fasta scores: E(): 1.2e-21, 26.873% id in 387 aa, FT and Haemophilus influenzae hypothetical protein TR:Q48156 FT (EMBL:Z37516) (789 aa) fasta scores: E(): 2e-33, 30.900% FT id in 411 aa. Similar to SAR0254, 79.211% identity FT (79.211% ungapped) in 558 aa overlap" FT /product="hypothetical protein" FT CDS complement(291010..291171) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0249" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS 291336..291461 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0250" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS 291714..292883 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0251" FT /note="Similar to the C-terminal regions of Bacillus FT subtilis teichoic acid biosynthesis protein F TagF FT SW:TAGF_BACSU (P13485) (746 aa) fasta scores: E(): FT 5.6e-77, 48.139% id in 403 aa, and to Staphylococcus FT epidermidis CDP-glycerol:poly(glycerolphosphate) FT glycerophosphotransferase TagF TR:Q9RPD1 (EMBL:AF162863) FT (721 aa) fasta scores: E(): 7e-72, 46.650% id in 403 aa" FT /product="putative teichoic acid biosynthesis protein" FT CDS 293159..293875 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0252" FT /note="Similar to the C-terminal region of Arabidopsis FT thaliana 4-diphosphocytidyl-2c-methyl-D-erythritol FT synthase IspD TR:Q9LL91 (EMBL:AF230737) (302 aa) fasta FT scores: E(): 4.7e-08, 25.877% id in 228 aa, and to the FT N-terminal region of Haemophilus influenzae CDP-ribitol FT pyrophosphorylase TR:Q48154 (EMBL:Z37516) (474 aa) fasta FT scores: E(): 1.5e-18, 36.957% id in 230 aa. Similar to FT SAR0246, 76.471% identity (76.471% ungapped) in 238 aa FT overlap" FT /product="conserved hypothetical protein" FT misc_feature 293162..293857 FT /note="Pfam match to entry PF01128 UPF0007, FT Uncharacterized protein family UPF0007, score 89.60, FT E-value 6.1e-23" FT /colour=9 FT CDS 293868..294893 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0253" FT /note="Similar to Escherichia coli L-idonate FT 5-dehydrogenase IdnD SW:IDND_ECOLI (P39346) (343 aa) fasta FT scores: E(): 6.7e-06, 23.006% id in 326 aa, and to Candida FT sp HA167 xylitol dehydrogenase Xdh TR:O74230 FT (EMBL:AF072541) (353 aa) fasta scores: E(): 5.1e-06, FT 24.425% id in 348 aa. Similar to SAR0247, 80.645% identity FT (80.645% ungapped) in 341 aa overlap" FT /product="putative zinc-binding dehydrogenase" FT misc_feature 293910..294884 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score 27.00, E-value 8.9e-09" FT /colour=9 FT CDS 294915..296603 FT /class="0.0.2" FT /colour=8 FT /locus_tag="SAR0254" FT /note="C-terminus is similar to Staphylococcus epidermidis FT epidermidis CDP-glycerol:poly(glycerolphosphate) FT glycerophosphotransferase TagF TR:Q9RPD1 (EMBL:AF162863) FT (721 aa) fasta scores: E(): 6.3e-19, 24.067% id in 536 aa. FT Full length CDS is similar to Haemophilus influenzae FT hypothetical protein TR:Q48156 (EMBL:Z37516) (789 aa) FT fasta scores: E(): 2.7e-32, 27.563% id in 595 aa. Similar FT to SAR0248, 79.211% identity (79.211% ungapped) in 558 aa FT overlap" FT /product="hypothetical protein" FT CDS 296636..298360 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0255" FT /note="No significant database matches to the full length FT CDS. C-terminus is similar to the C-terminal regions of FT Streptococcus thermophilus exopolysaccharide biosynthesis FT protein EpsI TR:Q56046 (EMBL:U40830) (324 aa) fasta FT scores: E(): 1e-11, 31.522% id in 276 aa, and FT Lactobacillus delbrueckii putative glycosyltransferase FT EpsJ TR:Q9F0B8 (EMBL:AF267127) (327 aa) fasta scores: E(): FT 6.7e-13, 29.851% id in 268 aa" FT /product="putative glycosyl transferase" FT misc_feature 296648..297136 FT /note="Pfam match to entry PF00535 Glycos_transf_2, FT Glycosyl transferase, score 136.20, E-value 5.8e-37" FT /colour=9 FT CDS 298500..299174 FT /class="1.7.1" FT /colour=3 FT /locus_tag="SAR0256" FT /gene="scdA" FT /note="Previously sequenced as Staphylococcus aureus cell FT wall metabolism protein ScdA TR:P72360 (EMBL:U57060) (224 FT aa) fasta scores: E(): 8.1e-81, 97.321% id in 224 aa. A FT scdA mutant had a grossly aberrant cellular morphology and FT formed large cell clusters when grown in liquid culture FT medium. Similar to Alcaligenes eutrophus plasmid (pHG1) FT hypothetical protein TR:O30367 (EMBL:AF002217) (227 aa) FT fasta scores: E(): 3.6e-14, 30.493% id in 223 aa" FT /product="cell wall metabolism protein" FT CDS 299425..301179 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0257" FT /gene="lytS" FT /note="Two-component regulatory system family, sensor FT kinase protein. Previously sequenced as Staphylococcus FT aureus autolysin sensor kinase LytS TR:Q53705 FT (EMBL:L42945) (584 aa) fasta scores: E(): 3.6e-213, FT 98.288% id in 584 aa. Similar to Bacillus subtilis FT autolysin sensor kinase lytS TR:P94513 (EMBL:Z75208) (593 FT aa) fasta scores: E(): 1.7e-102, 46.918% id in 584 aa" FT /product="autolysin sensor kinase protein" FT misc_feature join(299440..299508,299542..299610,299686..299754,299791..299844,299887..299940,299974..300042) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0257 by TMHMM2.0 at aa 6-28, 40-62, 88-110, 123-140, FT 155-172 and 184-206" FT misc_feature 300835..301164 FT /note="Pfam match to entry PF02518 HATPase_c, Histidine FT kinase-, DNA gyrase B-, phytochrome-like ATPase, score FT 48.70, E-value 4.4e-12" FT /colour=9 FT CDS 301182..301922 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0258" FT /gene="lytR" FT /note="Two-component regulatory system family, response FT regulator protein. Previously sequenced as Staphylococcus FT aureus autolysin response regulator LytR TR:P96456 FT (EMBL:L42945) (246 aa) fasta scores: E(): 9.6e-90, 98.780% FT id in 246 aa. Similar to Bacillus subtilis autolysin FT response regulator LytT TR:P94514 (EMBL:Z75208) (241 aa) FT fasta scores: E(): 4.4e-34, 40.664% id in 241 aa" FT /product="autolysin response regulator protein" FT misc_feature 301182..301541 FT /note="Pfam match to entry PF00072 response_reg, Response FT regulator receiver domain, score 112.60, E-value 7.6e-30" FT /colour=9 FT CDS 302035..302478 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0259" FT /gene="lrgA" FT /note="Previously sequenced as Staphylococcus aureus FT LytSR-regulated, holin-like protein LrgA TR:P72358 FT (EMBL:U52961) (147 aa) fasta scores: E(): 4.6e-49, FT 100.000% id in 147 aa. Similar to and to Bacillus subtilis FT hypothetical protein YsbA TR:P94515 (EMBL:Z75208) (146 aa) FT fasta scores: E(): 8.3e-18, 43.885% id in 139 aa" FT /product="holin-like protein" FT misc_feature join(302071..302130,302158..302226,302245..302313,302323..302391) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0259 by TMHMM2.0 at aa 13-32, 42-64, 71-93 and 97-119" FT CDS 302471..303172 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0260" FT /gene="lrgB" FT /note="Previously sequenced as Staphylococcus aureus FT LytSR-regulated, holin-like protein LrgB TR:P72359 FT (EMBL:U52961) (233 aa) fasta scores: E(): 6.8e-80, FT 100.000% id in 233 aa. Similar to Bacillus subtilis FT hypothetical protein YsbB TR:P94516 (EMBL:Z75208) (231 aa) FT fasta scores: E(): 3.7e-43, 58.296% id in 223 aa" FT /product="holin-like protein" FT misc_feature join(302483..302551,302570..302638,302669..302722,302759..302818,302846..302914,302933..303001,303098..303166) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0260 by TMHMM2.0 at aa 5-27, 34-56, 67-84, 97-116, FT 126-148, 155-177 and 210-232" FT CDS 303513..305804 FT /class="3.5.2" FT /colour=1 FT /locus_tag="SAR0261" FT /note="C-terminal region is similar to Pseudomonas FT aeruginosa nitric-oxide reductase subunit B NorB FT SW:NORB_PSEAE (Q59647) (466 aa) fasta scores: E(): 6e-24, FT 29.400% id in 483 aa. Full length CDS is similar to FT Alcaligenes eutrophus nitric oxide reductase TR:O30368 FT (EMBL:AF002217) (762 aa) fasta scores: E(): 1e-96, 35.894% FT id in 755 aa." FT /product="putative nitric oxide reductase" FT misc_feature 303513..303599 FT /note="Signal peptide predicted for SAR0261 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.983) with cleavage site FT probability 0.482 between residues 29 and 30" FT /colour=6 FT misc_feature join(303549..303608,304212..304280,304392..304460,304518..304586,304623..304691,304749..304817,304878..304946,304989..305057,305094..305162,305175..305243,305304..305372,305430..305489,305550..305618,305721..305774) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0261 by TMHMM2.0 at aa 13-32, 234-256, 294-316, FT 336-358, 371-393, 413-435, 456-478, 493-515, 528-550, FT 555-577, 598-620, 640-659, 680-702 and 737-754" FT misc_feature 304983..305153 FT /colour=8 FT /note="PS00077 Heme-copper oxidase catalytic subunit, FT copper B binding region signature." FT CDS complement(306030..306734) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0262" FT /note="Similar to Escherichia coli fatty acyl responsive FT regulator FarR SW:FARR_ECOLI (P13669) (240 aa) fasta FT scores: E(): 5.7e-11, 25.424% id in 236 aa, and to FT Bacillus subtilis hypothetical protein YydK TR:Q45591 FT (EMBL:D78193) (238 aa) fasta scores: E(): 7.3e-32, 40.870% FT id in 230 aa" FT /product="GntR family regulatory protein" FT misc_feature complement(306537..306716) FT /note="Pfam match to entry PF00392 gntR, Bacterial FT regulatory proteins, gntR family, score 54.60, E-value FT 2.6e-15" FT /colour=9 FT CDS 306881..307672 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0263" FT /note="Poor database matches to the full length CDS. FT Similar to the C-terminal regions of Staphylococcus FT carnosus PTS system, glucose-specific IIABC component GlcA FT TR:Q57071 (EMBL:X93360) (675 aa) fasta scores: E(): FT 1.1e-21, 33.065% id in 248 aa, and to Bacillus subtilis FT putative PTS system IIABC component YbfS SW:YBFS_BACSU FT (P39816) (631 aa) fasta scores: E(): 6.3e-18, 31.276% id FT in 243 aa" FT /product="putative PTS transport system protein" FT misc_feature 307271..307588 FT /note="Pfam match to entry PF00358 PTS_EIIA_1, FT phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 1, score 129.70, E-value 1.1e-35" FT /colour=9 FT misc_feature 307412..307450 FT /colour=8 FT /note="PS00371 PTS EIIA domains phosphorylation site FT signature 1." FT CDS 307688..309124 FT /EC_number="3.2.1.86" FT /class="3.4.3" FT /colour=6 FT /locus_tag="SAR0264" FT /gene="bglA" FT /note="Similar to Bacillus subtilis FT 6-phospho-beta-glucosidase BglA SW:BGLA_BACSU (P42973) FT (479 aa) fasta scores: E(): 1.3e-145, 70.146% id in 479 FT aa, and to Escherichia coli 6-phospho-beta-glucosidase FT BglA SW:BGLA_ECOLI (Q46829) (479 aa) fasta scores: E(): FT 1.6e-122, 60.714% id in 476 aa" FT /product="6-phospho-beta-glucosidase" FT misc_feature 307688..308221 FT /note="Pfam match to entry PF00232 Glyco_hydro_1, Glycosyl FT hydrolase family 1, score 234.50, E-value 1.5e-66" FT /colour=9 FT misc_feature 307709..307753 FT /colour=8 FT /note="PS00653 Glycosyl hydrolases family 1 N-terminal FT signature." FT misc_feature 308309..309112 FT /note="Pfam match to entry PF00232 Glyco_hydro_1, Glycosyl FT hydrolase family 1, score 269.70, E-value 3.8e-77" FT /colour=9 FT misc_feature 308804..308830 FT /colour=8 FT /note="PS00572 Glycosyl hydrolases family 1 active site." FT CDS complement(309619..310380) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0265" FT /note="Similar to Haemophilus influenzae hypothetical FT protein HI0095 SW:Y095_HAEIN (Q57060) (251 aa) fasta FT scores: E(): 6e-57, 58.333% id in 252 aa, and to FT Pasteurella multocida hypothetical protein PM1158 FT TR:Q9CLQ7 (EMBL:AE006156) (251 aa) fasta scores: E(): FT 4.3e-55, 57.540% id in 252 aa" FT /product="conserved hypothetical protein" FT CDS complement(310631..311545) FT /EC_number="2.7.1.15" FT /class="3.3.15" FT /colour=7 FT /locus_tag="SAR0266" FT /note="Similar to Escherichia coli ribokinase RbsK FT SW:RBSK_ECOLI (P05054) (309 aa) fasta scores: E(): FT 9.4e-39, 40.604% id in 298 aa, and to Lactobacillus FT bavaricus ribokinase RbsK rbsK TR:Q9X4M5 (EMBL:AF115391) FT (302 aa) fasta scores: E(): 2.7e-56, 54.181% id in 299 aa" FT /product="putative ribokinase" FT misc_feature complement(310652..311542) FT /note="Pfam match to entry PF00294 pfkB, pfkB family FT carbohydrate kinase, score 263.60, E-value 2.6e-75" FT /colour=9 FT misc_feature complement(310763..310804) FT /colour=8 FT /note="PS00584 pfkB family of carbohydrate kinases FT signature 2." FT CDS complement(311573..311977) FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0267" FT /note="Similar to Escherichia coli high affinity ribose FT transport protein RbsD SW:RBSD_ECOLI (P04982) (151 aa) FT fasta scores: E(): 1.9e-17, 43.262% id in 141 aa, and to FT Lactobacillus bavaricus ribose permease RbsD TR:Q9X4M4 FT (EMBL:AF115391) (131 aa) fasta scores: E(): 1.2e-21, FT 52.239% id in 134 aa" FT /product="putative ribose transport protein" FT CDS complement(311992..312873) FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0268" FT /note="Similar to Staphylococcus xylosus glucose uptake FT protein GlcU TR:O07881 (EMBL:Y14043) (288 aa) fasta FT scores: E(): 1.6e-26, 34.256% id in 289 aa, and to FT Lactobacillus bavaricus putative ribose transporter RbsU FT TR:Q9X4M3 (EMBL:AF115391) (294 aa) fasta scores: E(): FT 2.6e-60, 55.442% id in 294 aa" FT /product="putative sugar transport protein" FT misc_feature complement(join(311998..312057,312085..312153,312172..312240,312268..312336,312361..312414,312457..312510,312523..312591,312634..312687,312706..312774,312802..312870)) FT /colour=0 FT /note="10 probable transmembrane helices predicted for FT SAR0268 by TMHMM2.0 at aa 2-24, 34-56, 63-80, 95-117, FT 122-139, 154-171, 180-202, 212-234, 241-263 and 273-292" FT misc_feature complement(312799..312873) FT /note="Signal peptide predicted for SAR0268 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.929) with cleavage site FT probability 0.463 between residues 25 and 26" FT /colour=6 FT CDS complement(313105..314103) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0269" FT /note="Similar to Escherichia coli ribose operon repressor FT RbsR SW:RBSR_ECOLI (P25551) (329 aa) fasta scores: E(): FT 8.6e-27, 29.697% id in 330 aa, and to Lactobacillus FT bavaricus rbs operon repressor RbsR TR:Q9X4M6 FT (EMBL:AF115391) (335 aa) fasta scores: E(): 2.3e-39, FT 39.228% id in 311 aa" FT /product="LacI family regulatory protein" FT misc_feature complement(313132..313920) FT /note="Pfam match to entry PF00532 Peripla_BP_like, FT Periplasmic binding proteins and sugar binding domain of FT the LacI family., score 43.80, E-value 4e-09" FT /colour=9 FT misc_feature complement(314017..314100) FT /note="Pfam match to entry PF00356 lacI, Bacterial FT regulatory proteins, lacI family, score 49.50, E-value FT 1.3e-12" FT /colour=9 FT misc_feature complement(314029..314094) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 2168 FT (+6.57 SD) at aa 4-25, sequence VSIKDVAREAGVSVTTVSHILN" FT misc_feature complement(314032..314088) FT /colour=8 FT /note="PS00356 Bacterial regulatory proteins, lacI family FT signature." FT CDS 314320..314433 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0269a" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS 314483..314875 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0270" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(315004..316380) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0271" FT /note="Similar to Streptomyces lavendulae mitomycin export FT system protein Mct TR:Q9WVV3 (EMBL:AF127374) (484 aa) FT fasta scores: E(): 6e-22, 25.114% id in 438 aa, and to FT Pseudomonas aeruginosa probable MFS transporter PA2055 FT TR:Q9I260 (EMBL:AE004632) (471 aa) fasta scores: E(): FT 3.4e-24, 28.019% id in 414 aa" FT /product="putative transport protein" FT misc_feature complement(join(315031..315099,315142..315210,315244..315312,315325..315393,315427..315495,315511..315579,315640..315708,315718..315777,315835..315894,315904..315972,316009..316077,316087..316146,316183..316251,316279..316347)) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0271 by TMHMM2.0 at aa 12-34, 44-66, 79-98, 102-124, FT 137-159, 163-182, 202-221, 225-247, 268-290, 296-318, FT 330-352, 357-379, 391-413 and 428-450" FT misc_feature complement(316207..316380) FT /note="Signal peptide predicted for SAR0271 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.938) with cleavage site FT probability 0.705 between residues 58 and 59" FT /colour=6 FT CDS 316614..317606 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0272" FT /note="Similar to Bacillus sphaericus penicillin acylase FT SW:PAC_BACSH (P12256) (338 aa) fasta scores: E(): 8.1e-35, FT 29.483% id in 329 aa, and to Bacillus subtilis FT hypothetical protein YxeI SW:YXEI_BACSU (P54948) (328 aa) FT fasta scores: E(): 1.6e-35, 32.622% id in 328 aa" FT /product="putative choloylglycine hydrolase" FT misc_feature 316617..317558 FT /note="Pfam match to entry PF02275 CBAH, Choloylglycine FT hydrolase, score 231.10, E-value 1.6e-65" FT /colour=9 FT CDS 317932..318882 FT /class="2.1.0" FT /colour=3 FT /locus_tag="SAR0273" FT /gene="lytM" FT /note="Previously sequenced as Staphylococcus aureus FT peptidoglycan hydrolase LytM TR:O33599 (EMBL:L77194) (322 FT aa) fasta scores: E(): 3.4e-113, 98.418% id in 316 aa. FT C-terminus is similar to an internal region of FT Staphylococcus staphylolyticus lysostaphin precursor Lss FT SW:LSTP_STAST (P10548) (480 aa) fasta scores: E(): FT 4.8e-19, 48.905% id in 137 aa" FT /product="peptidoglycan hydrolase" FT misc_feature 317932..318006 FT /note="Signal peptide predicted for SAR0273 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.766 between residues 25 and 26" FT /colour=6 FT misc_feature 318601..318867 FT /note="Pfam match to entry PF01551 Peptidase_M37, FT Peptidase family M23/M37, score 141.60, E-value 1.4e-38" FT /colour=9 FT CDS complement(318934..319593) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0274" FT /note="Similar to the N-terminal regions of Streptococcus FT pyogenes putative ABC transporter SPY0744 TR:Q9A0K0 FT (EMBL:AE006526) (307 aa) fasta scores: E(): 4.9e-17, FT 38.278% id in 209 aa, and Bacillus halodurans hypothetical FT protein YfiL TR:Q9RC44 (EMBL:AB024563) (310 aa) fasta FT scores: E(): 1.7e-16, 36.408% id in 206 aa" FT /product="putative ABC transporter ATP-binding protein" FT misc_feature complement(318994..319515) FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 157.80, E-value 1.9e-43" FT /colour=9 FT misc_feature complement(319168..319212) FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT misc_feature complement(319471..319494) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(319607..320527) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0275" FT /note="Poor database matches. Similar to N-terminal FT regions of Streptococcus pyogenes putative ABC transporter FT SPY0746 TR:Q9A0J8 (EMBL:AE006526) (372 aa) fasta scores: FT E(): 0.0045, 24.542% id in 273 aa, and Pyrococcus FT horikoshii hypothetical protein PH1531 TR:O59200 FT (EMBL:AP000006) (420 aa) fasta scores: E(): 0.058, 21.683% FT id in 309 aa" FT /product="putative membrane protein" FT misc_feature complement(join(319613..319681,319694..319762,319781..319849,319907..319975,320417..320485)) FT /colour=0 FT /note="5 probable transmembrane helices predicted for FT SAR0275 by TMHMM2.0 at aa 15-37, 185-207, 227-249, 256-278 FT and 283-305" FT CDS complement(320524..321690) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0276" FT /note="Poor database matches. C-terminus is similar to FT internal regions of Borrelia burgdorferi conserved FT hypothetical integral membrane protein BB0584 TR:O51531 FT (EMBL:AE001160) (448 aa) fasta scores: E(): 0.48, 17.695% FT id in 243 aa, and to Buchnera aphidicola (subsp. FT Acyrthosiphon pisum) hypothetical transport protein BU466 FT SW:Y466_BUCAI (P57538) (390 aa) fasta scores: E(): 0.57, FT 22.778% id in 180 aa" FT /product="putative membrane protein" FT misc_feature complement(join(320539..320592,320686..320754,320788..320856,320899..320967,321028..321096,321565..321633)) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0276 by TMHMM2.0 at aa 20-42, 199-221, 242-264, FT 279-301, 313-335 and 367-384" FT misc_feature complement(321562..321690) FT /note="Signal peptide predicted for SAR0276 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.987) with cleavage site FT probability 0.981 between residues 43 and 44" FT /colour=6 FT CDS complement(321758..323281) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0277" FT /note="Poor database matches. Similar to N-terminal region FT of Homo sapiens cylicin I CYLC1 or cyl1 or cyL FT SW:CYL1_HUMAN (P35663) (598 aa) fasta scores: E(): FT 6.7e-05, 25.462% id in 487 aa" FT /product="putative exported protein" FT misc_feature complement(323192..323281) FT /note="Signal peptide predicted for SAR0277 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.998) with cleavage site FT probability 0.803 between residues 30 and 31" FT /colour=6 FT misc_feature complement(323195..323263) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0277 by TMHMM2.0 at aa 7-29" FT CDS complement(323611..324513) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0278" FT /note="Similar to Staphylococcus carnosus major secreted FT protein SceB TR:O54487 (EMBL:U96107) (263 aa) fasta FT scores: E(): 4.1e-16, 32.932% id in 249 aa, and to FT Staphylococcus epidermidis secretory antigen precursor FT SsaA TR:Q9KJT6 (EMBL:AF162275) (257 aa) fasta scores: E(): FT 8e-17, 31.457% id in 302 aa. C-terminus is similar to FT SAR2388, 59.821% identity (62.037% ungapped) in 112 aa FT overlap" FT /product="putative exported protein" FT misc_feature complement(324433..324513) FT /note="Signal peptide predicted for SAR0278 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.787 between residues 27 and 28" FT /colour=6 FT CDS 324752..325045 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0279" FT /note="Similar to Clostridium acetobutylicum hypothetical FT protein SW:YHS1_CLOAB (P34159) (96 aa) fasta scores: E(): FT 2.6e-09, 40.625% id in 96 aa, and to Bacillus halodurans FT hypothetical protein BH0972 TR:Q9KE84 (EMBL:AP001510) (96 FT aa) fasta scores: E(): 0.00013, 30.526% id in 95 aa" FT /product="conserved hypothetical protein" FT CDS 325128..328157 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0280" FT /note="Poor database matches. Internal region of the CDS FT is similar to an internal region of Entamoeba histolytica FT myosin heavy chain protein MhcA TR:Q07569 (EMBL:L03534) FT (2139 aa) fasta scores: E(): 0.00025, 21.216% id in 806 FT aa. Full length CDS is similar to Bacillus subtilis FT hypothetical protein YueB TR:O32101 (EMBL:Z99120) (1076 FT aa) fasta scores: E(): 2.8e-08, 20.631% id in 1110 aa" FT /product="putative membrane protein" FT misc_feature 325128..325208 FT /note="Signal peptide predicted for SAR0280 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.984) with cleavage site FT probability 0.573 between residues 27 and 28" FT /colour=6 FT misc_feature join(325140..325208,327588..327656,327717..327785,327828..327896,327909..327962,328059..328127) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0280 by TMHMM2.0 at aa 5-27, 821-843, 864-886, 901-923, FT 928-945 and 978-1000" FT CDS 328157..328615 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0281" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature 328499..328567 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0281 by TMHMM2.0 at aa 115-137" FT CDS 328587..328829 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0282" FT /note="Similar to Bacillus subtilis hypothetical protein FT YukD TR:P71071 (EMBL:Z82015) (79 aa) fasta scores: E(): FT 0.034, 26.923% id in 78 aa" FT /product="conserved hypothetical protein" FT CDS 328842..330176 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0283" FT /note="Similar to Bacillus subtilis hypothetical protein FT YukC TR:P71070 (EMBL:Z82015) (451 aa) fasta scores: E(): FT 2.6e-13, 24.088% id in 411 aa, and to Bacillus halodurans FT hypothetical protein BH0974 protein bh0974 TR:Q9KE82 FT (EMBL:AP001510) (440 aa) fasta scores: E(): 5.5e-12, FT 21.114% id in 431 aa. CDS contains C-terminal hydrophilic FT domain" FT /product="putative membrane protein" FT misc_feature 329526..329594 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0283 by TMHMM2.0 at aa 229-251" FT CDS 330198..334646 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0284" FT /note="Internal region is similar to Bacillus cereus FT diarrhoeal toxin BceT TR:P70871 (EMBL:D17312) (366 aa) FT fasta scores: E(): 2.1e-71, 57.746% id in 355 aa. FT C-terminal region is similar to Bacillus subtilis FT hypothetical protein YukA TR:P71068 (EMBL:Z99120) (1207 FT aa) fasta scores: E(): 2.1e-119, 38.767% id in 1233 aa" FT /product="putative membrane protein" FT misc_feature join(330885..330953,330966..331034) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0284 by TMHMM2.0 at aa 230-252 and 257-279" FT misc_feature 332079..332660 FT /note="Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family, score 140.70, E-value 2.5e-38" FT /colour=9 FT misc_feature 332211..332234 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 333105..333674 FT /note="Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family, score 125.60, E-value 9e-34" FT /colour=9 FT CDS 334649..334915 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0285" FT /note="No database matches" FT /product="hypothetical protein" FT CDS 334938..335333 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0286" FT /note="Hydrophilic protein. No significant database FT matches" FT /product="hypothetical protein" FT CDS 335355..337025 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0287" FT /note="Poor database matches. C-terminal region is similar FT to the N-terminus of Streptococcus thermophilus FT bacteriophage Sfi11 putative minor tail protein TR:O80179 FT (EMBL:AF158600) (1510 aa) fasta scores: E(): 1.1, 20.200% FT id in 500 aa" FT /product="hypothetical protein" FT CDS 337041..337685 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0288" FT /note="No significant database matches to the full length FT CDS. Weakly similar to the N-terminal region of FT Thermoplasma volcanium hypothetical protein TVG0160586 FT TR:BAB59293 (EMBL:AP000991) (469 aa) fasta scores: E(): FT 0.76, 26.154% id in 195 aa" FT /product="putative membrane protein" FT misc_feature join(337077..337145,337173..337229,337287..337355,337368..337436,337473..337541,337569..337628) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0288 by TMHMM2.0 at aa 13-35, 45-63, 83-105, 110-132, FT 145-167 and 177-196" FT CDS 337685..338140 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0289" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 338160..338591 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0290" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 338615..339202 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0291" FT /note="Poor database matches. Similar to internal regions FT of Archaeoglobus fulgidus putative quinone oxidoreductase FT subunit AF1831 TR:O28444 (EMBL:AE000976) (369 aa) fasta FT scores: E(): 1.3, 24.725% id in 182 aa, and to FT Enterococcus faecalis peptide antibiotic AS-48 maturation FT and biosynthesis protein AS-48B TR:O53024 (EMBL:Y12234) FT (563 aa) fasta scores: E(): 2.3, 26.738% id in 187 aa" FT /product="putative membrane protein" FT misc_feature 338615..338683 FT /note="Signal peptide predicted for SAR0291 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.789) with cleavage site FT probability 0.299 between residues 23 and 24" FT /colour=6 FT misc_feature join(338624..338680,338693..338761,338789..338857,338960..339013,339041..339109,339128..339196) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0291 by TMHMM2.0 at aa 4-22, 27-49, 59-81, 116-133, FT 143-165 and 172-194" FT CDS 339379..339597 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0292" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature 339388..339444 FT /colour=8 FT /note="PS00095 C-5 cytosine-specific DNA methylases FT C-terminal signature." FT misc_feature join(339412..339480,339523..339591) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0292 by TMHMM2.0 at aa 12-34 and 49-71" FT CDS 339729..340229 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0293" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH3703 TR:Q9K6M5 (EMBL:AP001519) (169 aa) fasta scores: FT E(): 7.3e-09, 28.659% id in 164 aa, and to C-terminal FT region of Bacillus subtilis hypothetical protein YeeF FT TR:O31506 (EMBL:Z99107) (827 aa) fasta scores: E(): FT 2.9e-10, 27.397% id in 146 aa. Similar to SAR0294, 66.061% FT identity (66.061% ungapped) in 165 aa overlap and to FT SAR0295, 72% identity in 157 aa overlap" FT /product="conserved hypothetical protein" FT CDS 340240..340740 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0294" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH3703 TR:Q9K6M5 (EMBL:AP001519) (169 aa) fasta scores: FT E(): 3.2e-08, 28.834% id in 163 aa, and to C-terminal FT region of Bacillus subtilis YeeF hypothetical protein FT TR:O31506 (EMBL:Z99107) (827 aa) fasta scores: E(): 1e-12, FT 32.000% id in 150 aa. Similar to SAR0293, 66.061% identity FT (66.061% ungapped) in 165 aa overlap" FT /product="conserved hypothetical protein" FT CDS join(340751..341104,341108..341239) FT /class="0.0.2" FT /colour=11 FT /locus_tag="SAR0295" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH3703 TR:Q9K6M5 (EMBL:AP001519) (169 aa) fasta scores: FT E(): 2.8e-09, 30.818% id in 159 aa, and to C-terminal FT region of Bacillus subtilis hypothetical protein YeeF FT TR:O31506 (EMBL:Z99107) (827 aa) fasta scores: E(): 7e-10, FT 30.556% id in 144 aa. Contains a nonsense mutation (opal) FT after codon 118" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS join(341250..341519,341523..341738) FT /class="0.0.2" FT /colour=11 FT /locus_tag="SAR0297" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH3703 TR:Q9K6M5 (EMBL:AP001519) (169 aa) fasta scores: FT E(): 5.4e-07, 30.189% id in 159 aa, and to Bacillus FT subtilis hypothetical protein YeeF TR:O31506 (EMBL:Z99107) FT (827 aa) fasta scores: E(): 6.1e-09, 28.082% id in 146 aa. FT Contains a nonsense mutation (ochre) after codon 90" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 342424..342750 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0299" FT /note="No significant database matches. Truncated at the FT N-terminus in comparison to N315 and Mu50 orthologues. FT Possible pseudogene" FT /product="hypothetical protein" FT CDS 342884..343282 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0301" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature 342884..342973 FT /note="Signal peptide predicted for SAR0301 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.997) with cleavage site FT probability 0.573 between residues 30 and 31" FT /colour=6 FT misc_feature join(342902..342970,343052..343120,343154..343222) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0301 by TMHMM2.0 at aa 7-29, 57-79 and 91-113" FT CDS complement(343532..344356) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0302" FT /note="Similar to Staphylococcus carnosus putative nitrite FT transporter NirC TR:Q9X2M6 (EMBL:AF029224) (276 aa) fasta FT scores: E(): 2.3e-42, 43.542% id in 271 aa, and to FT Bacillus subtilis hypothetical protein Ywcj SW:YWCJ_BACSU FT (P39608) (256 aa) fasta scores: E(): 6.7e-13, 28.571% id FT in 245 aa" FT /product="putative formate/nitrite transporter" FT misc_feature complement(343553..344299) FT /note="Pfam match to entry PF01226 Form_Nir_trans, FT Formate/nitrite transporter, score 57.50, E-value 3e-13" FT /colour=9 FT misc_feature complement(join(343565..343633,343709..343777,343796..343864,343940..344008,344066..344134,344177..344245)) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0302 by TMHMM2.0 at aa 38-60, 75-97, 117-139, 165-187, FT 194-216 and 242-264" FT CDS complement(344607..345914) FT /class="1.5.1" FT /colour=3 FT /locus_tag="SAR0303" FT /note="Similar to Corynebacterium glutamicum FT branched-chain amino acid transport system carrier protein FT BrnQ SW:BRNQ_CORGL (O06754) (426 aa) fasta scores: E(): FT 1.3e-45, 38.642% id in 427 aa, and to Bacillus subtilis FT branched-chain amino acid transport system carrier protein FT BrnQ SW:BRNQ_BACSU (P94499) (440 aa) fasta scores: E(): FT 1.7e-55, 38.928% id in 429 aa" FT /product="putative amino acid transport system" FT misc_feature complement(join(344634..344693,344736..344804,344841..344909,344919..344987,345024..345092,345180..345248,345282..345350,345420..345488,345522..345590,345633..345701,345738..345806,345834..345902)) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0303 by TMHMM2.0 at aa 5-27, 37-59, 72-94, 109-131, FT 143-165, 189-211, 223-245, 275-297, 310-332, 336-358, FT 371-393 and 408-427" FT misc_feature complement(345822..345914) FT /note="Signal peptide predicted for SAR0303 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.991) with cleavage site FT probability 0.391 between residues 31 and 32" FT /colour=6 FT CDS 346498..347388 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0304" FT /note="Similar to Haemophilus influenzae lipoprotein e FT precursor Hel SW:HEL_HAEIN (P26093) (274 aa) fasta scores: FT E(): 3e-24, 33.942% id in 274 aa, and to Streptococcus FT equisimilis cytoplasmic membrane lipoprotein precursor FT LppC TR:O05471 (EMBL:Y12602) (285 aa) fasta scores: E(): FT 2.4e-38, 43.448% id in 290 aa" FT /product="putative exported protein" FT misc_feature 346498..346590 FT /note="Signal peptide predicted for SAR0304 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.970 between residues 31 and 32" FT /colour=6 FT CDS 347637..348686 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0305" FT /note="Similar to Lactococcus lactis hypothetical protein FT YxeA TR:Q9CDG5 (EMBL:AE006454) (357 aa) fasta scores: E(): FT 2.3e-47, 44.077% id in 363 aa, and to Deinococcus FT radiodurans hypothetical protein DRA0279 TR:Q9RYN1 FT (EMBL:AE001863) (353 aa) fasta scores: E(): 3.6e-29, FT 31.818% id in 352 aa" FT /product="putative membrane protein" FT misc_feature 347637..347744 FT /note="Signal peptide predicted for SAR0305 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.863) with cleavage site FT probability 0.554 between residues 36 and 37" FT /colour=6 FT misc_feature join(347673..347741,348324..348392,348453..348521,348579..348647) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0305 by TMHMM2.0 at aa 13-35, 230-252, 273-295 and FT 315-337" FT misc_feature 348060..348680 FT /note="Pfam match to entry PF02687 DUF214, Predicted FT permease, score 30.50, E-value 5.7e-06" FT /colour=9 FT CDS 348699..349376 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0306" FT /note="Similar to Escherichia coli lipoprotein releasing FT system ATP-binding protein LolD SW:LOLD_ECOLI (P75957) FT (233 aa) fasta scores: E(): 3.8e-22, 37.387% id in 222 aa, FT and to Lactococcus lactis ABC transporter ATP-binding FT protein YxeB TR:Q9CDG4 (EMBL:AE006454) (223 aa) fasta FT scores: E(): 5.5e-38, 58.525% id in 217 aa" FT /product="ABC transporter ATP-binding protein" FT misc_feature 348789..349343 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 180.10, E-value 3.5e-50" FT /colour=9 FT misc_feature 348810..348833 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 349116..349160 FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT CDS 349584..350615 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0307" FT /note="Similar to Bacillus amyloliquefaciens PTS system, FT fructose-specific IIBC component FruA SW:PTFB_BACAM FT (P41029) (304 aa) fasta scores: E(): 1.4e-05, 27.304% id FT in 293 aa, and to Streptococcus pyogenes putative FT regulatory protein SPY0146 TR:Q9A1Q9 (EMBL:AE006484) (339 FT aa) fasta scores: E(): 8.5e-68, 59.467% id in 338 aa" FT /product="putative membrane protein" FT misc_feature 349584..349694 FT /note="Signal peptide predicted for SAR0307 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.912) with cleavage site FT probability 0.427 between residues 37 and 38" FT /colour=6 FT misc_feature join(349593..349652,349671..349724,349782..349841,349860..349928,349971..350039,350097..350156,350169..350237,350343..350411,350487..350555) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0307 by TMHMM2.0 at aa 4-23, 30-47, 67-86, 93-115, FT 130-152, 172-191, 196-218, 254-276 and 302-324" FT CDS 350958..352076 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0308" FT /note="Internal region is similar to Exiguobacterium FT acetylicum guanosine kinase Gsk TR:O24767 (EMBL:AB005149) FT (303 aa) fasta scores: E(): 4e-09, 26.000% id in 300 aa, FT Full length CDS is similar to Deinococcus radiodurans PfkB FT family carbohydrate kinase DR2312 TR:Q9RS15 FT (EMBL:AE002063) (383 aa) fasta scores: E(): 1.6e-25, FT 31.389% id in 360 aa. CDS contains an N-terminal FT helix-turn-helix domain, probable regulatory protein" FT /product="PfkB family carbohydrate kinase" FT misc_feature 351009..351074 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1997 FT (+5.99 SD) at aa 18-39, sequence ISQRELAEAIGLSRPSVANIIS" FT misc_feature 351126..352016 FT /note="Pfam match to entry PF00294 pfkB, pfkB family FT carbohydrate kinase, score 99.60, E-value 6.2e-26" FT /colour=9 FT misc_feature 351234..351308 FT /colour=8 FT /note="PS00583 pfkB family of carbohydrate kinases FT signature 1." FT misc_feature 351867..351908 FT /colour=8 FT /note="PS00584 pfkB family of carbohydrate kinases FT signature 2." FT CDS 352051..352974 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0309" FT /note="Similar to Escherichia coli hypothetical protein FT YeiN SW:YEIN_ECOLI (P33025) (312 aa) fasta scores: E(): FT 5.8e-59, 57.667% id in 300 aa, and to Erwinia chrysanthemi FT putative indigoidine systhesis protein IndA TR:Q9L393 FT (EMBL:AJ277403) (316 aa) fasta scores: E(): 6e-46, 43.478% FT id in 299 aa" FT /product="putative membrane protein" FT misc_feature 352360..352428 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0309 by TMHMM2.0 at aa 104-126" FT CDS 352985..354205 FT /class="1.5.5" FT /colour=3 FT /locus_tag="SAR0310" FT /note="Similar to Escherichia coli nucleoside permease FT NupC SW:NUPC_ECOLI (P33031) (400 aa) fasta scores: E(): FT 7.9e-56, 43.415% id in 410 aa, and to Bacillus halodurans FT nucleoside transporter BH1446 TR:Q9KCX3 (EMBL:AP001512) FT (406 aa) fasta scores: E(): 1.6e-38, 32.775% id in 418 aa" FT /product="putative nucleoside permease" FT misc_feature 352985..354202 FT /note="Pfam match to entry PF01773 Nucleoside_tra2, Na+ FT dependent nucleoside transporter, score 433.40, E-value FT 2e-126" FT /colour=9 FT misc_feature join(352994..353050,353084..353152,353246..353314,353558..353617,353774..353842,353861..353929,354023..354091,354128..354196) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0310 by TMHMM2.0 at aa 4-22, 34-56, 88-110, 192-211, FT 264-286, 293-315, 347-369 and 382-404" FT CDS complement(354310..355842) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0311" FT /note="Similar to the N-terminal regions of Rattus FT norvegicus sodium-dependent multivitamin transporter SMVT FT SW:SL56_RAT (O70247) (634 aa) fasta scores: E(): 5.9e-33, FT 27.613% id in 507 aa, and to Homo sapiens sodium-dependent FT multivitamin transporter SMVT SW:SL56_HUMAN (Q9Y289) (635 FT aa) fasta scores: E(): 7.8e-32, 26.531% id in 490 aa" FT /product="sodium:solute symporter family protein" FT misc_feature complement(join(354400..354468,354496..354549,354562..354630,354658..354726,354829..354897,354940..355008,355087..355155,355228..355284,355303..355371,355414..355482,355543..355611,355639..355707,355765..355833)) FT /colour=0 FT /note="13 probable transmembrane helices predicted for FT SAR0311 by TMHMM2.0 at aa 4-26, 46-68, 78-100, 121-143, FT 158-180, 187-205, 230-252, 279-301, 316-338, 373-395, FT 405-427, 432-449 and 459-481" FT misc_feature complement(354517..355728) FT /note="Pfam match to entry PF00474 SSF, Sodium:solute FT symporter family, score 38.60, E-value 3.7e-09" FT /colour=9 FT CDS complement(355882..356763) FT /class="2.1.3" FT /colour=5 FT /locus_tag="SAR0312" FT /note="Similar to Clostridium perfringens FT N-acetylneuraminate lyase NanA TR:O08360 (EMBL:Y12876) FT (288 aa) fasta scores: E(): 1.8e-60, 55.749% id in 287 aa, FT and to Haemophilus influenzae probable N-acetylneuraminate FT lyase subunit NanA SW:NPL_HAEIN (P44539) (293 aa) fasta FT scores: E(): 6.9e-61, 56.014% id in 291 aa" FT /product="putative N-acetylneuraminate lyase" FT misc_feature complement(355888..356754) FT /note="Pfam match to entry PF00701 DHDPS, FT Dihydrodipicolinate synthetase family, score 303.00, FT E-value 3.7e-87" FT /colour=9 FT CDS 356921..357781 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0313" FT /note="Similar to Streptomyces coelicolor glucokinase Glk FT SW:GLK_STRCO (P40184) (317 aa) fasta scores: E(): 8.2e-10, FT 28.571% id in 287 aa, and to Streptococcus pyogenes FT putative glucose kinase SPY0258 TR:Q9A1I4 (EMBL:AE006492) FT (312 aa) fasta scores: E(): 3.2e-21, 32.986% id in 288 aa" FT /product="putative ROK family protein" FT misc_feature 356933..357337 FT /note="Pfam match to entry PF00480 ROK, ROK family, score FT 65.40, E-value 2.3e-18" FT /colour=9 FT CDS complement(358058..358858) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0314" FT /note="Similar to Escherichia coli transcriptional FT repressor of rpiB expression, RpiR SW:RPIR_ECOLI (P39266) FT (296 aa) fasta scores: E(): 9.1e-07, 21.923% id in 260 aa, FT and to Lactococcus lactis transcriptional regulator YljC FT TR:Q9CGC1 (EMBL:AE006350) (273 aa) fasta scores: E(): FT 1.2e-13, 25.092% id in 271 aa" FT /product="putative transcription regulator" FT misc_feature complement(358118..358525) FT /note="Pfam match to entry PF01380 SIS, SIS domain, score FT 82.30, E-value 1e-20" FT /colour=9 FT misc_feature complement(358691..358756) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 996 FT (+2.58 SD) at aa 35-56, sequence STINSLAHAIGTSPATMTRFSH" FT CDS 358998..359666 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0315" FT /note="Similar to Clostridium perfringens putative FT N-acetylmannosamine-6-phosphate epimerase NanE TR:Q9S4L0 FT (EMBL:AF130859) (221 aa) fasta scores: E(): 1.8e-37, FT 52.995% id in 217 aa, and to Borrelia burgdorferi FT conserved hypothetical protein BB0644 TR:O51589 FT (EMBL:AE001166) (232 aa) fasta scores: E(): 1.3e-38, FT 54.795% id in 219 aa" FT /product="conserved hypothetical protein" FT CDS complement(359792..361105) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0316" FT /note="Similar to Vibrio cholerae hypothetical protein FT VCA0076 TR:Q9KN89 (EMBL:AE004350) (458 aa) fasta scores: FT E(): 9.5e-32, 29.345% id in 443 aa, and to Bacillus firmus FT hypothetical protein YkaA SW:YKAA_BACFI (P30267) (463 aa) FT fasta scores: E(): 1.6e-32, 29.318% id in 440 aa" FT /product="putative membrane protein" FT misc_feature complement(join(359801..359869,359897..359965,359984..360052,360062..360115,360128..360196,360350..360418,360437..360505,360548..360607,360668..360736,360800..360868,360887..360955,361013..361072)) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0316 by TMHMM2.0 at aa 12-31, 51-73, 80-102, 124-146, FT 167-186, 201-223, 230-252, 304-326, 331-348, 352-374, FT 381-403 and 413-435" FT CDS 361522..363597 FT /EC_number="3.1.1.3" FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0317" FT /gene="geh" FT /note="Similar to Staphylococcus aureus lipase (glycerol FT ester hydrolase) precursor Geh SW:LIP_STAAU (P10335) (690 FT aa) fasta scores: E(): 0, 97.829% id in 691 aa, and to FT Staphylococcus epidermidis lipase precursor GehD TR:Q9Z4M7 FT (EMBL:AF090142) (643 aa) fasta scores: E(): 1.1e-83, FT 44.250% id in 687 aa" FT /product="lipase precursor" FT misc_feature 361522..361632 FT /note="Signal peptide predicted for SAR0317 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.792 between residues 37 and 38" FT /colour=6 FT misc_feature 362677..362700 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 362740..362769 FT /colour=8 FT /note="PS00120 Lipases, serine active site." FT CDS complement(363839..364666) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0318" FT /note="Poor database matches. Similar to Rhodococcus sp FT putative hydroxymuconic-semialdehyde hydrolase OhpC FT TR:Q9KH20 (EMBL:AF274045) (289 aa) fasta scores: E(): FT 0.51, 23.507% id in 268 aa" FT /product="hypothetical protein" FT CDS complement(364724..365938) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0319" FT /note="N-terminus is similar to the N-terminal region of FT Thermoanaerobacter brockii NADH oxidase SW:NADO_THEBR FT (P32382) (651 aa) fasta scores: E(): 7.8e-17, 26.554% id FT in 354 aa. Full length CDS is similar to Streptococcus FT pyogenes putative trimethylamine dehydrogenase SPY1219 FT TR:Q99ZI3 (EMBL:AE006562) (399 aa) fasta scores: E(): FT 1.1e-92, 56.853% id in 394 aa" FT /product="NADH:flavin oxidoreductase / NADH oxidase family FT protein" FT misc_feature complement(364901..365923) FT /note="Pfam match to entry PF00724 oxidored_FMN, FT NADH:flavin oxidoreductase / NADH oxidase family, score FT 177.40, E-value 2.4e-49" FT /colour=9 FT CDS 366246..367247 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0320" FT /note="Similar to Streptococcus pyogenes hypothetical FT protein SPY1218 TR:Q99ZI4 (EMBL:AE006562) (332 aa) fasta FT scores: E(): 1.6e-50, 42.470% id in 332 aa, and to FT Bacillus subtilis hypothetical protein YwcH SW:YWCH_BACSU FT (P39606) (333 aa) fasta scores: E(): 6e-39, 38.690% id in FT 336 aa" FT /product="putative bacterial luciferase family protein" FT misc_feature 366249..367175 FT /note="Pfam match to entry PF00296 bac_luciferase, FT Bacterial luciferase, score 53.00, E-value 6.4e-12" FT /colour=9 FT CDS 367281..367613 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0321" FT /note="Similar to an internal region of Drosophila FT melanogaster mitochondrial glycine cleavage system H FT protein Ppl SW:GCSH_DROME (Q9U616) (165 aa) fasta scores: FT E(): 4.6e-07, 34.653% id in 101 aa. Full length CDS is FT similar to Streptococcus pyogenes putative glycine FT cleavage system H protein SPY1217 TR:Q99ZI5 FT (EMBL:AE006562) (110 aa) fasta scores: E(): 4.2e-22, FT 60.000% id in 110 aa" FT /product="putative glycine cleavage H-protein" FT misc_feature 367401..367568 FT /note="Pfam match to entry PF01597 GCV_H, Glycine cleavage FT H-protein, score 27.50, E-value 2.5e-06" FT /colour=9 FT CDS 367614..368414 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0322" FT /note="Poor database matches. Similar to Streptococcus FT pyogenes hypothetical protein SPY1216 TR:Q99ZI6 FT (EMBL:AE006562) (270 aa) fasta scores: E(): 6.5e-39, FT 47.280% id in 239 aa. C-terminal region of the CDS is FT similar to Escherichia coli hypothetical protein TR:P75918 FT (EMBL:AE000206) (177 aa) fasta scores: E(): 1.9e-15, FT 37.569% id in 181 aa" FT /product="conserved hypothetical protein" FT misc_feature 367920..368297 FT /note="Pfam match to entry PF01661 A1pp, Appr-1 -p FT processing enzyme family, score 108.70, E-value 1.1e-28" FT /colour=9 FT CDS 368401..369348 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0323" FT /note="Similar to Streptococcus pyogenes hypothetical FT protein SPY1215 TR:Q99ZI7 (EMBL:AE006562) (293 aa) fasta FT scores: E(): 1.6e-70, 63.838% id in 271 aa, and to FT Mycoplasma pulmonis hypothetical protein MYPU_4420 FT TR:CAC13615 (EMBL:AL445564) (282 aa) fasta scores: E(): FT 3.8e-55, 50.379% id in 264 aa" FT /product="conserved hypothetical protein" FT CDS 369326..370348 FT /class="3.3.21" FT /colour=7 FT /locus_tag="SAR0324" FT /note="Similar to Escherichia coli lipoate-protein ligase FT A LplA SW:LPLA_ECOLI (P32099) (337 aa) fasta scores: E(): FT 6.6e-17, 28.896% id in 308 aa, and to Streptococcus FT pyogenes putative lipoate-protein ligase LplA TR:Q99ZI8 FT (EMBL:AE006562) (339 aa) fasta scores: E(): 2.9e-84, FT 62.059% id in 340 aa" FT /product="putative lipoate-protein ligase A" FT misc_feature 369383..370078 FT /note="Pfam match to entry PF02539 Lipoate_A, FT Lipoate-protein ligase A, score 117.60, E-value 2.3e-31" FT /colour=9 FT CDS 370661..371689 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0325" FT /note="Similar to Gerbera hybrida FT dihydroflavonol-4-reductase Dfr SW:DFRA_GERHY (P51105) FT (366 aa) fasta scores: E(): 1.1e-20, 32.931% id in 331 aa, FT and to Rhizobium loti probable cinnamoyl-CoA reductase FT MLL1975 TR:BAB49218 (EMBL:AP002998) (355 aa) fasta scores: FT E(): 1e-40, 37.681% id in 345 aa" FT /product="putative reductase" FT misc_feature 371234..371263 FT /colour=8 FT /note="PS00152 ATP synthase alpha and beta subunits FT signature." FT CDS complement(371783..373129) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0326" FT /note="Similar to Escherichia coli hypothetical protein FT TR:CAC39291 (EMBL:AJ278144) (418 aa) fasta scores: E(): FT 2.8e-86, 57.143% id in 413 aa, and to Streptococcus FT pyogenes hypothetical protein SPY1949 TR:Q99XZ3 FT (EMBL:AE006618) (411 aa) fasta scores: E(): 3.6e-62, FT 47.493% id in 379 aa" FT /product="putative membrane protein" FT misc_feature complement(join(371810..371911,371954..372022,372041..372109,372119..372187,372281..372349,372392..372460,372629..372697,372707..372775,372794..372853,373043..373111)) FT /colour=0 FT /note="10 probable transmembrane helices predicted for FT SAR0326 by TMHMM2.0 at aa 7-29, 93-112, 119-141, 145-167, FT 224-246, 261-283, 315-337, 341-363, 370-392 and 407-440" FT misc_feature complement(372518..372541) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(373144..373428) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0327" FT /note="Similar to Escherichia coli unknown pentitol FT phosphotransferase enzyme IIB component SgaB SW:PTXB_ECOLI FT (P39302) (101 aa) fasta scores: E(): 0.18, 29.787% id in FT 94 aa, and to Escherichia coli hypothetical protein FT TR:Q9AI23 (EMBL:AF286670) (95 aa) fasta scores: E(): FT 4.6e-08, 36.082% id in 97 aa" FT /product="putative PTS transport system protein" FT CDS complement(373430..373873) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0328" FT /note="Similar to Escherichia coli cryptic mannitol PTS FT transport system protein CmtB SW:PTYA_ECOLI (P32058) (147 FT aa) fasta scores: E(): 4.1e-14, 35.714% id in 140 aa, and FT to Escherichia coli unknown pentitol phosphotransferase FT enzyme IIA component SgaA SW:PTXA_ECOLI (P39303) (154 aa) FT fasta scores: E(): 1.6e-10, 27.273% id in 143 aa" FT /product="putative PTS transport system IIA component" FT misc_feature complement(373436..373864) FT /note="Pfam match to entry PF00359 PTS_EIIA_2, FT Phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 2, score 96.00, E-value 7.3e-25" FT /colour=9 FT CDS complement(373878..375833) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0329" FT /note="Similar to Bacillus subtilis putative cel operon FT regulator CelR SW:CELR_BACSU (P46321) (641 aa) fasta FT scores: E(): 3.3e-35, 28.063% id in 506 aa, and to FT Streptococcus pyogenes putative transcriptional FT antiterminator SPY1325 TR:Q99Z99 (EMBL:AE006571) (664 aa) FT fasta scores: E(): 3.2e-23, 22.430% id in 642 aa" FT /product="putative PTS multidomain regulator" FT misc_feature complement(373896..374321) FT /note="Pfam match to entry PF00359 PTS_EIIA_2, FT Phosphoenolpyruvate-dependent sugar phosphotransferase FT system, EIIA 2, score 11.90, E-value 1.1e-06" FT /colour=9 FT misc_feature complement(374667..374942) FT /note="Pfam match to entry PF00874 BglG_antitermin, FT Transcriptional antiterminator bglG family, score 41.90, FT E-value 1.4e-08" FT /colour=9 FT misc_feature complement(375003..375290) FT /note="Pfam match to entry PF00874 BglG_antitermin, FT Transcriptional antiterminator bglG family, score 48.90, FT E-value 1.1e-10" FT /colour=9 FT misc_feature complement(375456..375521) FT /colour=2 FT /note="Predicted helix-turn-helix motif for SAR0329 with FT score 1440.000, SD 4.09 at aa 105-126, sequence FT VSTKQLAQDVNVSRRTIADDIK" FT misc_feature complement(375711..375776) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1474 FT (+4.21 SD) at aa 20-41, sequence IPINTIANQLGVSPRTIQYDIA" FT CDS 376045..376464 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0330" FT /note="Similar to Erwinia carotovora antibiotic production FT and exoenzyme virulence determinants regulatory protein, FT Hor SW:HOR_ERWCA (Q9RB09) (145 aa) fasta scores: E(): FT 0.0022, 26.357% id in 129 aa, and to Lactococcus lactis FT putative transcriptional regulator RmaE TR:Q9CFJ4 FT (EMBL:AE006378) (139 aa) fasta scores: E(): 2.7e-10, FT 29.851% id in 134 aa" FT /product="MarR family regulatory protein" FT misc_feature 376129..376446 FT /note="Pfam match to entry PF01047 MarR, MarR family, FT score 58.40, E-value 1.5e-13" FT /colour=9 FT misc_feature 376186..376251 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1531 FT (+4.40 SD) at aa 48-69, sequence LTQNDIAKALQRTGPTVSNLLR" FT CDS 376571..377926 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0331" FT /note="Similar to Lactococcus lactis hypothetical protein FT YpbC TR:Q9CFJ2 (EMBL:AE006378) (459 aa) fasta scores: E(): FT 9.6e-53, 38.636% id in 440 aa, and to Thermotoga maritima FT conserved hypothetical protein TM1701 TR:Q9X227 FT (EMBL:AE001810) (458 aa) fasta scores: E(): 1.4e-27, FT 29.787% id in 423 aa" FT /product="putative membrane protein" FT misc_feature join(376628..376696,376724..376792,376853..376921,376964..377032,377069..377137,377150..377218,377306..377374,377417..377485,377522..377590,377633..377701,377735..377803,377813..377881) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0331 by TMHMM2.0 at aa 20-42, 52-74, 95-117, 132-154, FT 167-189, 194-216, 246-268, 283-305, 318-340, 355-377, FT 389-411 and 415-437" FT misc_feature 376637..377125 FT /note="Pfam match to entry PF01554 UPF0013, FT Uncharacterized membrane protein family UPF0013, score FT 94.90, E-value 1.6e-24" FT /colour=9 FT misc_feature 376949..376996 FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' dimerization FT domain signature." FT misc_feature 377303..377785 FT /note="Pfam match to entry PF01554 UPF0013, FT Uncharacterized membrane protein family UPF0013, score FT 53.30, E-value 5.5e-12" FT /colour=9 FT CDS 378032..378472 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0332" FT /note="Poor database matches. Similar to an internal FT region of Borrelia burgdorferi lipoprotein TR:Q44816 FT (EMBL:U45424) (203 aa) fasta scores: E(): 9.9, 28.571% id FT in 133 aa" FT /product="hypothetical protein" FT CDS complement(378556..379914) FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0333" FT /gene="glpT" FT /note="Similar to Bacillus subtilis glycerol-3-phosphate FT transporter GlpT SW:GLPT_BACSU (P37948) (444 aa) fasta FT scores: E(): 1.2e-112, 61.863% id in 451 aa, and to FT Pseudomonas aeruginosa glycerol-3-phosphate transporter FT GlpT TR:Q9HTV5 (EMBL:AE004936) (448 aa) fasta scores: E(): FT 1.3e-103, 60.091% id in 441 aa" FT /product="putative glycerol-3-phosphate transporter" FT misc_feature complement(join(378589..378657,378670..378738,378775..378843,378871..378924,378958..379017,379075..379134,379270..379329,379372..379440,379501..379560,379570..379638,379657..379725,379783..379836)) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0333 by TMHMM2.0 at aa 27-44, 64-86, 93-115, 119-138, FT 159-181, 196-215, 261-280, 300-319, 331-348, 358-380, FT 393-415 and 420-442" FT misc_feature complement(379411..379461) FT /colour=8 FT /note="PS00942 glpT family of transporters signature." FT CDS 380226..381152 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0334" FT /note="Similar to Sphingomonas chlorophenolica FT 2,6-dichloro-p-hydroxyquinone chlorohydrolase PcpA FT TR:Q9ZBB0 (EMBL:M55159) (320 aa) fasta scores: E(): FT 9.2e-13, 26.625% id in 323 aa, and to Bacillus subtilis FT putative dioxygenase YkcA TR:O34689 (EMBL:Z99110) (316 aa) FT fasta scores: E(): 3.5e-40, 37.812% id in 320 aa" FT /product="putative dioxygenase" FT misc_feature 380259..380633 FT /note="Pfam match to entry PF00903 Glyoxalase, FT Glyoxalase/Bleomycin resistance protein/Dioxygenase FT superfamily, score 44.30, E-value 1.6e-11" FT /colour=9 FT misc_feature 380709..380948 FT /note="Pfam match to entry PF00903 Glyoxalase, FT Glyoxalase/Bleomycin resistance protein/Dioxygenase FT superfamily, score 15.10, E-value 0.0044" FT /colour=9 FT CDS 381166..382227 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0335" FT /note="Similar to Vibrio fischeri alkanal monooxygenase FT alpha chain protein LuxA TR:Q9S3Z1 (EMBL:AF170104) (354 FT aa) fasta scores: E(): 7.1e-07, 22.515% id in 342 aa, and FT to Bacillus amyloliquefaciens hypothetical protein FT TR:Q9F9Q6 (EMBL:AF181997) (356 aa) fasta scores: E(): FT 1.8e-55, 45.115% id in 348 aa" FT /product="putative luciferase-like monooxygenase" FT misc_feature 381199..382206 FT /note="Pfam match to entry PF00296 bac_luciferase, FT Bacterial luciferase, score 69.50, E-value 7.2e-17" FT /colour=9 FT CDS join(382241..382375,382379..382807) FT /class="7.0.0" FT /colour=11 FT /locus_tag="SAR0336" FT /note="Similar to Pseudomonas aeruginosa NADH-dependent FT FMN reductase MsuE SW:MSUE_PSEAE (O31038) (186 aa) fasta FT scores: E(): 1.4e-08, 28.313% id in 166 aa, and to FT Rhizobium loti NADH-dependent FMN reductase MsuE FT TR:BAB51711 (EMBL:AP003006) (186 aa) fasta scores: E(): FT 1.8e-07, 26.829% id in 164 aa. Contains a nonsense FT mutation (ochre) after codon 45" FT /product="NADH-dependent FMN reductase (pseudogene)" FT /pseudo FT CDS complement(382867..383862) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0338" FT /note="Similar to Escherichia coli hypothetical protein FT YeiH SW:YEIH_ECOLI (P33019) (349 aa) fasta scores: E(): FT 1.6e-28, 32.381% id in 315 aa, and to Rhizobium loti FT hypothetical protein MlR2225 TR:BAB49407 (EMBL:AP002999) FT (325 aa) fasta scores: E(): 9.1e-28, 28.616% id in 318 aa" FT /product="putative membrane protein" FT misc_feature complement(join(382873..382941,382978..383046,383056..383124,383161..383214,383257..383316,383335..383403,383431..383499,383518..383586,383599..383658,383719..383772,383785..383838)) FT /colour=0 FT /note="11 probable transmembrane helices predicted for FT SAR0338 by TMHMM2.0 at aa 9-26, 31-48, 69-88, 93-115, FT 122-144, 154-176, 183-202, 217-234, 247-269, 273-295 and FT 308-330" FT misc_feature complement(383752..383862) FT /note="Signal peptide predicted for SAR0338 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.527 between residues 37 and 38" FT /colour=6 FT CDS 384222..384767 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0339" FT /note="Similar to Escherichia coli FT ribosomal-protein-serine acetyltransferase RimL FT SW:RIML_ECOLI (P13857) (179 aa) fasta scores: E(): FT 1.2e-13, 29.586% id in 169 aa, and to Bacillus subtilis FT probable acetyltransferase YdaF TR:P96579 (EMBL:AB001488) FT (183 aa) fasta scores: E(): 1.2e-26, 45.405% id in 185 FT aaSimilar to SAR0718, 68.085% identity (68.085% ungapped) FT in 329 aa overlap" FT /product="putative acetyltransferase" FT misc_feature 384426..384671 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 54.60, E-value FT 2.1e-12" FT /colour=9 FT CDS 385032..385886 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0340" FT /note="Similar to the C-terminal regions of Streptomyces FT coelicolor putative lipoprotein SCC75A.21 TR:Q9RKQ3 FT (EMBL:AL133220) (384 aa) fasta scores: E(): 2.1e-32, FT 44.361% id in 266 aa, and Bacillus subtilis hypothetical FT protein YwbM SW:YWBM_BACSU (P39596) (385 aa) fasta scores: FT E(): 1.9e-28, 42.353% id in 255 aa" FT /product="putative lipoprotein" FT misc_feature 385032..385106 FT /note="Signal peptide predicted for SAR0340 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.666 between residues 25 and 26" FT /colour=6 FT misc_feature 385053..385085 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 385883..387112 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0341" FT /note="Similar to Bacillus subtilis hypothetical protein FT SW:YWBN_BACSU (P39597) (416 aa) fasta scores: E(): FT 1.6e-40, 40.338% id in 414 aa, and to Streptomyces FT coelicolor putative membrane protein SCC75A.22 TR:Q9RKQ2 FT (EMBL:AL133220) (420 aa) fasta scores: E(): 4.4e-40, FT 40.793% id in 429 aa" FT /product="putative Sec-independent exported protein" FT misc_feature 385943..386002 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0341 by TMHMM2.0 at aa 21-40" FT CDS 387093..388805 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0342" FT /note="Similar to the C-terminal regions of Pasteurella FT multocida hypothetical protein PM0453 TR:Q9CNH8 FT (EMBL:AE006081) (634 aa) fasta scores: E(): 3.3e-18, FT 23.304% id in 575 aa, and Campylobacter jejuni putative FT integral membrane protein CJ1658 TR:Q9PM19 (EMBL:AL139079) FT (696 aa) fasta scores: E(): 2.1e-16, 25.497% id in 604 aa" FT /product="putative membrane protein" FT misc_feature 387093..387176 FT /note="Signal peptide predicted for SAR0342 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.857 between residues 28 and 29" FT /colour=6 FT misc_feature join(387105..387164,388155..388223,388266..388319,388380..388439,388497..388565,388584..388652,388743..388796) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0342 by TMHMM2.0 at aa 5-24, 355-377, 392-409, 430-449, FT 469-491, 498-520 and 551-568" FT CDS complement(389116..389817) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0343" FT /note="Similar to Escherichia coli Sec-independent protein FT translocase protein TatC or MttB SWALL:TATC_ECOLI FT (SWALL:P27857) (258 aa) fasta scores: E(): 2e-15, 30.17% FT id in 232 aa, and to Bacillus halodurans hypothetical FT protein BH0553 SW:YDIJ_BACHD (Q9Z9P4) (253 aa) fasta FT scores: E(): 2.2e-27, 37.229% id in 231 aa" FT /product="putative Sec-independent protein translocase FT protein" FT misc_feature complement(join(389152..389205,389215..389268,389326..389394,389452..389520,389578..389646,389716..389784)) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0343 by TMHMM2.0 at aa 12-34, 58-80, 100-122, 142-164, FT 184-201 and 205-222" FT misc_feature complement(389188..389793) FT /note="Pfam match to entry PF00902 UPF0032, MttB family FT UPF0032, score 145.00, E-value 1.4e-39" FT /colour=9 FT CDS complement(389834..390049) FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0344" FT /note="Similar to the N-terminal region of Escherichia FT coli Sec-independent protein translocase protein TatA or FT MttA1 SWALL:TATA_ECOLI (SWALL:O65938) (89 aa) fasta FT scores: E(): 0.048, 36% id in 50 aa. Full length CDS is FT similar to Bacillus halodurans hypothetical protein BH3905 FT TR:Q9K627 (EMBL:AP001520) (68 aa) fasta scores: E(): FT 1.3e-07, 56.250% id in 64 aa" FT /product="putative Sec-independent protein translocase FT protein" FT misc_feature complement(389858..390019) FT /note="Pfam match to entry PF02416 MttA_Hcf106, FT mttA/Hcf106 family, score 71.80, E-value 1.5e-17" FT /colour=9 FT misc_feature complement(389969..390037) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0344 by TMHMM2.0 at aa 5-27" FT CDS complement(390157..390546) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0345" FT /note="Poor database matches. Similar to Lactococcus FT lactis hypothetical protein YcfH TR:Q9CIU6 (EMBL:AE006263) FT (137 aa) fasta scores: E(): 0.19, 26.400% id in 125 aa" FT /product="conserved hypothetical protein" FT CDS 390786..390989 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0346" FT /note="Similar to Streptococcus pyogenes putative FT transcriptional regulator protein SPY1386 TR:Q99Z58 FT (EMBL:AE006576) (71 aa) fasta scores: E(): 1.3e-14, FT 65.672% id in 67 aa, and to Archaeoglobus fulgidus FT hypothetical transcriptional regulator AF1627 FT SW:YG27_ARCFU (O28646) (71 aa) fasta scores: E(): 1.2e-09, FT 47.761% id in 67 aa" FT /product="putative DNA-binding protein" FT misc_feature 390798..390962 FT /note="Pfam match to entry PF01381 HTH_3, FT Helix-turn-helix, score 57.70, E-value 2.6e-13" FT /colour=9 FT misc_feature 390825..390890 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 2314 FT (+7.07 SD) at aa 14-35, sequence LNQTQLAKQAGVSRQTISLIER" FT CDS 390986..391699 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0347" FT /note="Similar to Streptococcus pyogenes hypothetical FT protein SPY1385 TR:Q99Z59 (EMBL:AE006576) (253 aa) fasta FT scores: E(): 1, 23.016% id in 252 aa, and to an internal FT region of Bacillus halodurans hypothetical protein BH1986 FT TR:Q9KBE2 (EMBL:AP001513) (439 aa) fasta scores: E(): 3.5, FT 27.556% id in 225 aa" FT /product="putative membrane protein" FT misc_feature join(391004..391072,391115..391174,391268..391336,391364..391423,391544..391612,391622..391678) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0347 by TMHMM2.0 at aa 7-29, 44-63, 95-117, 127-146, FT 187-209 and 213-231" FT CDS 391724..392566 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0348" FT /note="Similar to Bacillus subtilis ATP-binding transport FT protein NatA SW:NATA_BACSU (P46903) (246 aa) fasta scores: FT E(): 1.6e-11, 28.854% id in 253 aa, and to Bacillus FT halodurans ABC transporter BH0652 TR:Q9KF34 FT (EMBL:AP001509) (288 aa) fasta scores: E(): 4.6e-20, FT 33.083% id in 266 aa" FT /product="ABC transporter ATP-binding protein" FT misc_feature 391814..392344 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 148.80, E-value 9.2e-41" FT /colour=9 FT misc_feature 391835..391858 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 392566..393195 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0349" FT /note="Similar to Staphylococcus xylosus hypothetical FT protein TR:O33816 (EMBL:Y14599) (209 aa) fasta scores: FT E(): 8.7e-32, 48.357% id in 213 aa, and to Butyrivibrio FT fibrisolvens butyrivibriocin AR10 operon protein BviB FT TR:Q9ZGP7 (EMBL:AF076529) (216 aa) fasta scores: E(): FT 0.033, 22.667% id in 225 aa" FT /product="putative membrane protein" FT misc_feature 392566..392685 FT /note="Signal peptide predicted for SAR0349 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.813) with cleavage site FT probability 0.764 between residues 40 and 41" FT /colour=6 FT misc_feature join(392608..392676,392803..392871,392881..392949,392983..393051,393094..393162) FT /colour=0 FT /note="5 probable transmembrane helices predicted for FT SAR0349 by TMHMM2.0 at aa 15-37, 80-102, 106-128, 140-162 FT and 177-199" FT CDS complement(393564..394697) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0350" FT /note="Poor database matches. C-terminus is similar to FT Listeria monocytogenes low temperature requirement protein FT A LtrA TR:Q9ZIM4 (EMBL:AF023180) (324 aa) fasta scores: FT E(): 2.9e-11, 25.387% id in 323 aa. Full length CDS is FT similar to C-terminal region of Rhizobium meliloti FT hypothetical protein SW:YSY3_RHIME (O33683) (451 aa) fasta FT scores: E(): 0.00015, 21.180% id in 373 aa" FT /product="putative membrane protein" FT misc_feature complement(join(393597..393653,393666..393722,393741..393809,393852..393920,393954..394013,394026..394094,394128..394196,394209..394277,394314..394382,394395..394448,394485..394553,394581..394640)) FT /colour=0 FT /note="12 probable transmembrane helices predicted for FT SAR0350 by TMHMM2.0 at aa 20-39, 49-71, 84-101, 106-128, FT 141-163, 168-190, 202-224, 229-248, 260-282, 297-319, FT 326-344 and 349-367" FT CDS 395237..396418 FT /EC_number="2.3.1.9" FT /class="3.6.1" FT /colour=7 FT /locus_tag="SAR0351" FT /gene="thl" FT /gene="thlA" FT /note="Similar to Clostridium acetobutylicum acetyl-CoA FT acetyltransferase Thl SW:THL_CLOAB (P45359) (392 aa) fasta FT scores: E(): 5e-81, 57.653% id in 392 aa, and to FT Clostridium thermosaccharolyticum acetyl coenzyme A FT acetyltransferase ThlA TR:P77852 (EMBL:Z82038) (392 aa) FT fasta scores: E(): 1.1e-82, 58.929% id in 392 aa" FT /product="acetyl-CoA acetyltransferase" FT misc_feature 395237..396028 FT /note="Pfam match to entry PF00108 thiolase, Thiolase, FT N-terminal domain, score 538.10, E-value 6.1e-158" FT /colour=9 FT misc_feature 395486..395542 FT /colour=8 FT /note="PS00098 Thiolases acyl-enzyme intermediate FT signature." FT misc_feature 396038..396409 FT /note="Pfam match to entry PF02803 thiolase_C, Thiolase, FT C-terminal domain, score 224.00, E-value 2.1e-63" FT /colour=9 FT misc_feature 396251..396301 FT /colour=8 FT /note="PS00737 Thiolases signature 2." FT misc_feature 396353..396394 FT /colour=8 FT /note="PS00099 Thiolases active site." FT CDS complement(396501..397253) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0352" FT /note="Similar to Pasteurella multocida hypothetical FT protein PM0097 TR:Q9CPE7 (EMBL:AE006045) (247 aa) fasta FT scores: E(): 7.6e-50, 51.867% id in 241 aa, and to FT Rhizobium loti hypothetical protein MLR5444 TR:BAB51895 FT (EMBL:AP003006) (263 aa) fasta scores: E(): 3.3e-19, FT 32.500% id in 240 aa" FT /product="conserved hypothetical protein" FT CDS complement(397296..399524) FT /EC_number="2.1.1.14" FT /class="3.1.14" FT /colour=7 FT /locus_tag="SAR0353" FT /gene="metE" FT /note="Similar to Escherichia coli FT 5-methyltetrahydropteroyltriglutamate--homocysteine FT methyltransferase (cobalamin-independent methionine FT synthase) MetE SW:METE_ECOLI (P25665) (752 aa) fasta FT scores: E(): 6.5e-97, 44.401% id in 759 aa, and to FT Bacillus halodurans FT 5-methyltetrahydropteroyltriglutamate--homocysteine FT methyltransferase MetE SW:METE_BACHD (Q9KFP1) (756 aa) FT fasta scores: E(): 1.1e-110, 51.798% id in 751 aa" FT /product="5-methyltetrahydropteroyltriglutamate--homocyst FT eine methyltransferase" FT misc_feature complement(397311..398282) FT /note="Pfam match to entry PF01717 Methionine_synt, FT Methionine synthase, vitamin-B12 independent, score FT 602.90, E-value 1.9e-177" FT /colour=9 FT CDS complement(399521..401362) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0354" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH1629 TR:Q9KCE2 (EMBL:AP001512) (618 aa) fasta scores: FT E(): 1.6e-109, 46.962% id in 609 aa, and to Bacillus FT subtilis putative hypothetical protein YitJ TR:O06745 FT (EMBL:Y09476) (612 aa) fasta scores: E(): 1.4e-107, FT 45.902% id in 610 aa" FT /product="conserved hypothetical protein" FT misc_feature complement(399554..400441) FT /note="Pfam match to entry PF02219 MTHFR, FT Methylenetetrahydrofolate reductase, score -42.00, E-value FT 5.2e-09" FT /colour=9 FT misc_feature complement(400511..401329) FT /note="Pfam match to entry PF02574 S-methyl_trans, FT Homocysteine S-methyltransferase, score 202.40, E-value FT 6.8e-57" FT /colour=9 FT CDS complement(401331..402491) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0355" FT /note="Similar to Lactococcus lactis (subsp. cremoris) FT (Streptococcus cremoris) cystathionine beta-lyase MetC FT TR:Q9RAS9 (EMBL:AF131880) (380 aa) fasta scores: E(): FT 8e-61, 47.887% id in 355 aa, and to Lactobacillus reuteri FT cystathionine beta-lyase TR:Q9FCU8 (EMBL:AJ293860) (380 FT aa) fasta scores: E(): 8.2e-66, 49.304% id in 359 aa" FT /product="Cys/Met metabolism PLP-dependent enzyme" FT misc_feature complement(401373..402476) FT /note="Pfam match to entry PF01053 Cys_Met_Meta_PP, FT Cys/Met metabolism PLP-dependent enzyme, score 546.40, FT E-value 2e-160" FT /colour=9 FT misc_feature complement(401886..401930) FT /colour=8 FT /note="PS00868 Cys/Met metabolism enzymes FT pyridoxal-phosphate attachment site." FT CDS complement(402488..403591) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0356" FT /note="Similar to Lactococcus lactis (subsp. cremoris) FT (Streptococcus cremoris) cystathionine beta-lyase MetC FT TR:Q9RAS9 (EMBL:AF131880) (380 aa) fasta scores: E(): FT 3.6e-39, 41.096% id in 365 aa, and to Bacillus subtilis FT hypothetical protein YjcI TR:O31631 (EMBL:Z99110) (373 aa) FT fasta scores: E(): 2e-66, 49.863% id in 365 aa" FT /product="Cys/Met metabolism PLP-dependent enzyme" FT misc_feature complement(402515..403585) FT /note="Pfam match to entry PF01053 Cys_Met_Meta_PP, FT Cys/Met metabolism PLP-dependent enzyme, score 475.40, FT E-value 4.6e-139" FT /colour=9 FT misc_feature complement(402995..403039) FT /colour=8 FT /note="PS00868 Cys/Met metabolism enzymes FT pyridoxal-phosphate attachment site." FT misc_RNA complement(403755..404014) FT /note="T-box leader as predicted by Rfam (RF00230), score FT 42.98" FT CDS 404255..405100 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0357" FT /note="Similar to Bacillus subtilis stage 0 sporulation FT protein T Spo0J SW:SP0J_BACSU (P26497) (282 aa) fasta FT scores: E(): 1.3e-37, 45.802% id in 262 aa, and to FT Listeria monocytogenes hypothetical protein ParB TR:Q9FCV8 FT (EMBL:AJ010494) (283 aa) fasta scores: E(): 1.3e-40, FT 49.811% id in 265 aa" FT /product="putative DNA-binding protein" FT misc_feature 404315..404584 FT /note="Pfam match to entry PF02195 ParBc, ParB-like FT nuclease domain, score 130.50, E-value 3e-35" FT /colour=9 FT misc_feature 404651..404716 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1788 FT (+5.28 SD) at aa 133-154, sequence ITQQEVAKRLSKSRPYIANMLR" FT CDS 405254..406135 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0358" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH2666 TR:Q9K9I1 (EMBL:AP001516) (276 aa) fasta scores: FT E(): 9.8e-26, 34.815% id in 270 aa, and to Bacillus FT subtilis hypothetical protein YkuT TR:O34897 FT (EMBL:AJ222587) (267 aa) fasta scores: E(): 2.4e-22, FT 35.772% id in 246 aa" FT /product="putative membrane protein" FT misc_feature join(405311..405379,405458..405526,405554..405613) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0358 by TMHMM2.0 at aa 20-42, 69-91 and 101-120" FT misc_feature 405476..406090 FT /note="Pfam match to entry PF00924 MS_channel, FT Uncharacterized protein family UPF0003, score 169.30, FT E-value 6.3e-47" FT /colour=9 FT CDS 406165..406368 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0359" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH4052 TR:Q9K5N6 (EMBL:AP001520) (65 aa) fasta scores: FT E(): 6.3e-13, 54.237% id in 59 aa, and to Streptococcus FT pyogenes hypothetical protein SPY0004 TR:Q9A208 FT (EMBL:AE006472) (65 aa) fasta scores: E(): 4.4e-09, FT 50.000% id in 62 aa" FT /product="conserved hypothetical protein" FT CDS 406380..407477 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0360" FT /note="Similar to Bacillus subtilis hypothetical FT GTP-binding protein YyaF SW:YYAF_BACSU (P37518) (366 aa) FT fasta scores: E(): 1.1e-93, 72.678% id in 366 aa, and to FT Bacillus halodurans GTP-binding protein BH4051 TR:Q9K5N7 FT (EMBL:AP001520) (366 aa) fasta scores: E(): 2.1e-88, FT 69.945% id in 366 aa" FT /product="putative GTP-binding protein" FT misc_feature 406395..406661 FT /note="Pfam match to entry PF01018 GTP1_OBG, GTP1/OBG FT family, score 21.20, E-value 7.3e-05" FT /colour=9 FT misc_feature 406404..406427 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS complement(407563..407754) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0361" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 407998..408294 FT /class="4.2.2" FT /colour=2 FT /locus_tag="SAR0362" FT /gene="rpsF" FT /note="Similar to Bacillus subtilis 30S ribosomal protein FT S6 RpsF SW:RS6_BACSU (P21468) (95 aa) fasta scores: E(): FT 1.5e-23, 67.708% id in 96 aa, and to Streptococcus FT pyogenes 30S ribosomal protein S6 RpsF TR:Q99Y79 FT (EMBL:AE006609) (96 aa) fasta scores: E(): 3.8e-19, FT 56.842% id in 95 aa" FT /product="30S ribosomal protein S6" FT misc_feature 408001..408279 FT /note="Pfam match to entry PF01250 Ribosomal_S6, Ribosomal FT protein S6, score 131.60, E-value 1.4e-35" FT /colour=9 FT misc_feature 408127..408156 FT /colour=8 FT /note="PS01048 Ribosomal protein S6 signature." FT CDS 408315..408818 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0363" FT /gene="ssb" FT /note="Similar to Bacillus subtilis single-strand binding FT protein Ssb SW:SSB_BACSU (P37455) (172 aa) fasta scores: FT E(): 7.6e-40, 67.429% id in 175 aa, and to bacteriophage FT A118 putative single-strand binding protein Ssb protein FT TR:Q9T160 (EMBL:AJ242593) (160 aa) fasta scores: E(): FT 8.1e-35, 59.281% id in 167 aa. Similar to SAR2083, 68.862% FT identity (73.718% ungapped) in 167 aa overlap" FT /product="putative single-strand DNA-binding protein" FT misc_feature 408318..408356 FT /colour=8 FT /note="PS00735 Single-strand binding protein family FT signature 1." FT misc_feature 408318..408626 FT /note="Pfam match to entry PF00436 SSB, Single-strand FT binding protein family, score 186.40, E-value 1.4e-54" FT /colour=9 FT CDS 408870..409112 FT /class="4.2.2" FT /colour=2 FT /locus_tag="SAR0364" FT /gene="rpsR" FT /note="Similar to Bacillus subtilis 30S ribosomal protein FT S18 RpsR SW:RS18_BACSU (P21475) (78 aa) fasta scores: E(): FT 5.7e-23, 79.747% id in 79 aa, and to Bacillus FT stearothermophilus 30S ribosomal protein S18 RpsR FT SW:RS18_BACST (P10806) (77 aa) fasta scores: E(): 2.1e-22, FT 81.333% id in 75 aa" FT /product="30S ribosomal protein S18" FT misc_feature 408927..409088 FT /note="Pfam match to entry PF01084 Ribosomal_S18, FT Ribosomal protein S18, score 125.80, E-value 8.2e-34" FT /colour=9 FT misc_feature 408945..409016 FT /colour=8 FT /note="PS00057 Ribosomal protein S18 signature." FT repeat_region 409098..409115 FT /note="Genomic island repeat, SaPI4rep1" FT misc_feature 409116..424268 FT /note="Putative pathogenicity island. Absent in N315, FT Mu50, Col and NCTC8325. Similar to SaPI1, SaPI3 and FT SaPIbov" FT /colour=0 FT /label=SaPI4 FT repeat_region 409153..409169 FT /note="Genomic island repeat, SaPI4rep2" FT CDS complement(409344..410063) FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0365" FT /note="Poor database matches. Similar to the C-terminal FT regions of Streptococcus pyogenes conserved hypothetical FT protein-phage associated protein SPY0938 TR:Q9A043 FT (EMBL:AE006542) (269 aa) fasta scores: E(): 4.1e-09, FT 30.638% id in 235 aa, and to Cryptosporidium parvum FT hypothetical protein TR:Q9GRY1 (EMBL:AJ293269) (483 aa) FT fasta scores: E(): 7.5, 25.941% id in 239 aa" FT /product="hypothetical protein" FT CDS complement(410176..411390) FT /class="5.1.2" FT /colour=12 FT /locus_tag="SAR0366" FT /note="Similar to bacteriophage phi PVL, and FT Staphylococcus aureus temperate phage phiSLT, integrase FT TR:O80068 (EMBL:AB009866) (401 aa) fasta scores: E(): FT 2e-52, 38.765% id in 405 aa, and to bacteriophage bIL312 FT integrase Int TR:Q9AZF9 (EMBL:AF323673) (382 aa) fasta FT scores: E(): 1e-15, 35.468% id in 406 aa" FT /product="putative integrase" FT misc_feature complement(410209..410835) FT /note="Pfam match to entry PF00589 Phage_integrase, Phage FT integrase family, score 132.80, E-value 6.4e-36" FT /colour=9 FT CDS complement(411551..412174) FT /class="7.0.0" FT /colour=12 FT /locus_tag="SAR0367" FT /note="Similar to bacteriophage bIL311 cI-like repressor FT TR:Q9AZH9 (EMBL:AF323672) (235 aa) fasta scores: E(): 1.9, FT 25.822% id in 213 aa, and to Staphylococcus aureus FT putative pathogenicity island protein Orf20 TR:Q9F0J8 FT (EMBL:AF217235) (267 aa) fasta scores: E(): 1.4, 26.961% FT id in 204 aa" FT /product="DNA-binding protein" FT misc_feature complement(411959..412129) FT /note="Pfam match to entry PF01381 HTH_3, FT Helix-turn-helix, score 28.80, E-value 0.00013" FT /colour=9 FT misc_feature complement(412037..412102) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1132 FT (+3.04 SD) at aa 25-46, sequence KTASEISKQMQYSQGHISGIEN" FT CDS 412269..412487 FT /class="7.0.0" FT /colour=12 FT /locus_tag="SAR0368" FT /note="Similar to bacteriophage SPP1 hypothetical protein FT Orf37.3 TR:Q38149 (EMBL:X67865) (57 aa) fasta scores: E(): FT 2.7, 27.660% id in 47 aa, and to Streptomyces coelicolor FT hypothetical protein SCE68.26C TR:Q9WX06 (EMBL:AL079345) FT (70 aa) fasta scores: E(): 0.5, 29.091% id in 55 aa" FT /product="putative DNA-binding protein" FT misc_feature 412329..412394 FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1368 FT (+3.85 SD) at aa 21-42, sequence MTVKEVAQLLRISERHTYKLLQ" FT CDS 412488..412760 FT /class="0.0.2" FT /colour=12 FT /locus_tag="SAR0369" FT /note="Similar to bacteriophage phi PVL hypothetical FT protein Orf37 TR:O80076 (EMBL:AB009866) (87 aa) fasta FT scores: E(): 2.3e-07, 37.079% id in 89 aa, and to FT Staphylococcus aureus temperate phage phiSLT hypothetical FT protein TR:Q9B0G8 (EMBL:AB045978) (87 aa) fasta scores: FT E(): 2.6e-06, 33.708% id in 89 aa" FT /product="conserved hypothetical protein" FT CDS 412772..412945 FT /class="4.1.7" FT /colour=12 FT /locus_tag="SAR0370" FT /note="No significant database matches" FT /product="putative exported protein" FT misc_feature 412772..412858 FT /note="Signal peptide predicted for SAR0370 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.962) with cleavage site FT probability 0.811 between residues 29 and 30" FT /colour=6 FT misc_feature 412790..412858 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0370 by TMHMM2.0 at aa 7-29" FT CDS 412912..413058 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0371" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 413116..413499 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0372" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf17 FT TR:Q9F0K1 (EMBL:AF217235) (127 aa) fasta scores: E(): FT 4.9e-47, 98.425% id in 127 aa" FT /product="hypothetical protein" FT CDS 413500..413826 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0373" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf16 FT TR:Q9F0K2 (EMBL:AF217235) (105 aa) fasta scores: E(): FT 3.2e-14, 45.370% id in 108 aa" FT /product="hypothetical protein" FT CDS 413891..414760 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0374" FT /note="Similar to Lactococcus bacteriophage phi31 FT hypothetical protein TR:Q9G0E4 (EMBL:AJ292531) (268 aa) FT fasta scores: E(): 0.0017, 21.961% id in 255 aa, and to FT Staphylococcus aureus putative pathogenicity island FT protein Orf15 TR:Q9F0K3 (EMBL:AF217235) (289 aa) fasta FT scores: E(): 1.3e-116, 95.502% id in 289 aa" FT /product="hypothetical protein" FT CDS 414774..416483 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0375" FT /note="Poor database matches. N-terminus is similar to FT Staphylococcus aureus putative pathogenicity island FT protein Orf14 TR:Q9F0K4 (EMBL:AF217235) (278 aa) fasta FT scores: E(): 4.9e-95, 98.545% id in 275 aa. and C-terminus FT is similar to Staphylococcus aureus putative pathogenicity FT island protein Orf13 TR:Q9F0K5 (EMBL:AF217235) (293 aa) FT fasta scores: E(): 4.5e-94, 89.273% id in 289 aa" FT /product="hypothetical protein" FT misc_feature 415467..415490 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT CDS 416793..417173 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0376" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf12 FT TR:Q9F0K6 (EMBL:AF217235) (126 aa) fasta scores: E(): FT 1.3e-49, 96.825% id in 126 aa" FT /product="hypothetical protein" FT CDS 417170..417811 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0377" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf11 FT TR:Q9F0K7 (EMBL:AF217235) (213 aa) fasta scores: E(): FT 8.4e-76, 93.897% id in 213 aa" FT /product="hypothetical protein" FT CDS 418519..418863 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0378" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf10 FT TR:Q9F0K8 (EMBL:AF217235) (113 aa) fasta scores: E(): FT 8.4e-38, 91.667% id in 108 aa" FT /product="hypothetical protein" FT CDS 418894..419547 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0379" FT /note="Poor database matches. Similar to Plasmodium FT falciparum hypothetical protein PFC0075c TR:O97331 FT (EMBL:AL034560) (284 aa) fasta scores: E(): 1.7, 26.154% FT id in 195 aa" FT /product="hypothetical protein" FT CDS 419600..420127 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0380" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf7 FT TR:Q9F0L1 (EMBL:AF217235) (191 aa) fasta scores: E(): FT 7.7e-61, 96.000% id in 175 aa. CDS is truncated at the FT C-terminus in comparison to the pathogenicity island FT protein" FT /product="hypothetical protein" FT CDS 420130..420471 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0381" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf6 FT TR:Q9F0L2 (EMBL:AF217235) (113 aa) fasta scores: E(): FT 2.4e-40, 93.805% id in 113 aa" FT /product="hypothetical protein" FT CDS 420468..421037 FT /class="5.1.2" FT /colour=12 FT /locus_tag="SAR0382" FT /note="Similar to bacteriophage SF6, and bacteriophage FT rho-15 terminase small subunit SW:TERS_BPSF6 (Q38627) (151 FT aa) fasta scores: E(): 8.6e-06, 34.568% id in 162 aa, and FT to Staphylococcus aureus putative pathogenicity island FT protein Orf5 TR:Q9F0L3 (EMBL:AF217235) (189 aa) fasta FT scores: E(): 6.2e-67, 97.884% id in 189 aa" FT /product="putative terminase small subunit" FT CDS 421314..422282 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0383" FT /note="No significant database matches to the full length FT CDS. C-terminus is similar to C-terminal region of FT Lactococcus lactis plasmid (pNP40) abortive bacteriophage FT infection protein AbiF TR:Q48618 (EMBL:U36837) (342 aa) FT fasta scores: E(): 0.00068, 22.857% id in 280 aa. FT N-terminus is similar to N-terminal region of Pasteurella FT multocida hypothetical protein PM1540 TR:Q9CKR6 FT (EMBL:AE006190) (309 aa) fasta scores: E(): 1.3e-08, FT 24.731% id in 279 aa" FT /product="hypothetical protein" FT CDS 422460..422861 FT /class="0.0.0" FT /colour=12 FT /locus_tag="SAR0384" FT /note="Poor database matches. Similar to an internal FT region of Streptococcus thermophilus bacteriophage 7201 FT hypothetical protein Orf2 TR:Q9MCM9 (EMBL:AF145054) (175 FT aa) fasta scores: E(): 1.8e-08, 36.290% id in 124 aa" FT /product="hypothetical protein" FT CDS 422979..423491 FT /class="4.1.6" FT /colour=12 FT /locus_tag="SAR0385" FT /note="Poor database matches. Similar to Staphylococcus FT aureus putative pathogenicity island protein Orf3 FT TR:Q9F0L5 (EMBL:AF217235) (170 aa) fasta scores: E(): FT 1.3e-50, 99.412% id in 170 aa" FT /product="putative membrane protein" FT misc_feature 422979..423077 FT /note="Signal peptide predicted for SAR0385 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.998 between residues 33 and 34" FT /colour=6 FT misc_feature join(423339..423407,423417..423485) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0385 by TMHMM2.0 at aa 121-143 and 147-169" FT repeat_region 424197..424214 FT /note="Genomic island repeat, SaPI4rep1" FT repeat_region 424252..424268 FT /note="Genomic island repeat, SaPI4rep2" FT CDS complement(424449..425456) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0386" FT /note="Poor database matches. Weakly similar to FT Pasteurella multocida hypothetical protein PM1540 FT TR:Q9CKR6 (EMBL:AE006190) (309 aa) fasta scores: E(): 9.9, FT 22.101% id in 276 aa" FT /product="hypothetical protein" FT CDS complement(join(425462..425542,425542..425781,425781..425888,425888..426052)) FT /class="5.1.2" FT /colour=11 FT /locus_tag="SAR0387" FT /note="Probable gene remnant. Similar to the C-terminal FT regions of Bacteriophage L54a integrase Int FT SWALL:VINT_BPL54 (SWALL:P20709) (354 aa) fasta scores: FT E(): 3e-19, 39.06% id in 192 aa, and Staphylococcus aureus FT bacteriophage PVL, and Staphylococcus aureus temperate FT phage phiSLT integrase SWALL:O80068 (EMBL:AB009866) (401 FT aa) fasta scores: E(): 5e-20, 36.18% id in 199 aa. CDS FT contains several frameshift mutations. Similar to the FT C-terminal region of SAR0366" FT /partial FT /product="integrase (partial)" FT CDS 426413..426781 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0389" FT /note="Similar to Bacillus subtilis hypothetical protein FT YxeA SW:YXEA_BACSU (P54940) (115 aa) fasta scores: E(): FT 2.7e-06, 29.091% id in 110 aa, and to Lactococcus lactis FT hypothetical protein YpaG TR:Q9CFJ9 (EMBL:AE006378) (115 FT aa) fasta scores: E(): 9e-05, 31.405% id in 121 aa" FT /product="putative exported protein" FT misc_feature 426413..426508 FT /note="Signal peptide predicted for SAR0389 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.616) with cleavage site FT probability 0.460 between residues 32 and 33" FT /colour=6 FT misc_feature 426431..426484 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0389 by TMHMM2.0 at aa 7-24" FT CDS 426962..427534 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0390" FT /note="Similar to Campylobacter jejuni putative acidic FT periplasmic protein CJ0424 TR:Q9PI81 (EMBL:AL139075) (210 FT aa) fasta scores: E(): 0.93, 25.500% id in 200 aa. FT C-terminus is similar to the C-terminal region of Bacillus FT subtilis hypothetical protein YkoI TR:O34551 FT (EMBL:AJ002571) (226 aa) fasta scores: E(): 0.29, 24.138% FT id in 145 aa" FT /product="putative lipoprotein" FT misc_feature 426962..427021 FT /note="Signal peptide predicted for SAR0390 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.578 between residues 20 and 21" FT /colour=6 FT misc_feature 426986..427018 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS complement(427672..427935) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0391" FT /note="Poor database matches. Similar to the N-terminal FT region of Lactococcus lactis putative transcriptional FT regulator YnaB TR:Q9CG39 (EMBL:AE006359) (252 aa) fasta FT scores: E(): 4.3, 27.273% id in 77 aa" FT /product="hypothetical protein" FT CDS 428229..428483 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0392" FT /note="Similar to Bacillus subtilis hypothetical protein FT YdaS TR:P96594 (EMBL:AB001488) (85 aa) fasta scores: E(): FT 9.2e-11, 46.429% id in 84 aa, and to Lactococcus lactis FT hypothetical protein YmgJ TR:Q9CG68 (EMBL:AE006356) (80 FT aa) fasta scores: E(): 6.6e-08, 46.479% id in 71 aa" FT /product="putative membrane protein" FT misc_feature join(428238..428297,428316..428384,428394..428462) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0392 by TMHMM2.0 at aa 4-23, 30-52 and 56-78" FT CDS complement(428522..428731) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0393" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS 428909..429490 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0394" FT /note="Similar to Schizosaccharomyces pombe FT phosphoglycerate mutase SPAC26F1.06 SW:PMGY_SCHPO (P36623) FT (211 aa) fasta scores: E(): 3.7e-05, 25.000% id in 196 aa, FT and to Rhizobium loti phosphoglycerate mutase MLR4643 FT TR:BAB51251 (EMBL:AP003004) (206 aa) fasta scores: E(): FT 3.2e-07, 29.146% id in 199 aa" FT /product="phosphoglycerate mutase family protein" FT misc_feature 428909..429487 FT /note="Pfam match to entry PF00300 PGAM, Phosphoglycerate FT mutase family, score 74.90, E-value 1.7e-18" FT /colour=9 FT misc_feature 428921..428950 FT /colour=8 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature." FT CDS complement(429556..429939) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0395" FT /note="Similar to Bacillus subtilis hypothetical protein FT YdeH TR:P96665 (EMBL:AB001488) (148 aa) fasta scores: E(): FT 0.00021, 27.344% id in 128 aa. CDS is truncated at the FT N-terminus in comparison to B. subtilis protein" FT /product="putative membrane protein" FT misc_feature complement(join(429589..429657,429670..429738,429757..429825,429868..429921)) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0395 by TMHMM2.0 at aa 7-24, 39-61, 68-90 and 95-117" FT misc_feature complement(429835..429939) FT /note="Signal peptide predicted for SAR0395 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.391 between residues 35 and 36" FT /colour=6 FT CDS 430027..430134 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR395a" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS complement(430210..430836) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0396" FT /note="Similar to Bacillus subtilis hypothetical protein FT YkyA SW:YKYA_BACSU (P21884) (237 aa) fasta scores: E(): FT 0.71, 23.077% id in 221 aa, and to Bacillus subtilis FT hypothetical protein YkyA TR:Q45496 (EMBL:AF012285) (205 FT aa) fasta scores: E(): 4.1, 22.927% id in 205 aa" FT /product="putative lipoprotein" FT misc_feature complement(430774..430836) FT /note="Signal peptide predicted for SAR0396 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.678 between residues 21 and 22" FT /colour=6 FT misc_feature complement(430777..430809) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS complement(430909..432528) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0397" FT /note="Similar to an internal region of Amsacta moorei FT entomopoxvirus hypothetical protein AMV156 TR:Q9EMP3 FT (EMBL:AF250284) (1238 aa) fasta scores: E(): 0.81, 19.540% FT id in 522 aa. Internal region of the CDS is similar to FT N-terminal region of bacteriophage SPBc2 hypothetical FT protein YolJ TR:O64036 (EMBL:AF020713) (422 aa) fasta FT scores: E(): 0.98, 20.323% id in 310 aa" FT /product="hypothetical protein" FT CDS complement(432643..434166) FT /EC_number="1.6.4.-" FT /class="1.4.2" FT /colour=0 FT /locus_tag="SAR0398" FT /gene="ahpF" FT /note="Similar to Xanthomonas campestris alkyl FT hydroperoxide reductase subunit F AhpF SW:AHPF_XANCH FT (O06465) (530 aa) fasta scores: E(): 1.8e-95, 53.876% id FT in 516 aa. Previously sequenced as Staphylococcus aureus FT alkyl hydroperoxide reductase subunit F AhpF SW:AHPF_STAAU FT (O05204) (507 aa) fasta scores: E(): 2.9e-181, 98.817% id FT in 507 aa" FT /product="alkyl hydroperoxide reductase subunit F" FT misc_feature complement(432703..433548) FT /note="Pfam match to entry PF00070 pyr_redox, Pyridine FT nucleotide-disulphide oxidoreductase, score 237.90, FT E-value 1.4e-67" FT /colour=9 FT misc_feature complement(432874..432906) FT /colour=8 FT /note="PS00626 Regulator of chromosome condensation (RCC1) FT signature 2." FT misc_feature complement(433102..433164) FT /colour=8 FT /note="PS00573 Pyridine nucleotide-disulphide FT oxidoreductases class-II active site." FT CDS complement(434182..434751) FT /EC_number="1.6.4.-" FT /class="1.4.2" FT /colour=0 FT /locus_tag="SAR0399" FT /gene="ahpC" FT /note="Similar to Salmonella typhimurium alkyl FT hydroperoxide reductase, C22 protein, AhpC SW:AHPC_SALTY FT (P19479) (186 aa) fasta scores: E(): 5.2e-47, 65.426% id FT in 188 aa. Previously sequenced as Staphylococcus aureus, FT and alkyl hydroperoxide reductase subunit C AhpC TR:Q53647 FT (EMBL:U92441) (189 aa) fasta scores: E(): 5.1e-74, FT 100.000% id in 189 aa" FT /product="alkyl hydroperoxide reductase subunit C" FT misc_feature complement(434293..434742) FT /note="Pfam match to entry PF00578 AhpC-TSA, AhpC/TSA FT family, score 217.30, E-value 2.3e-61" FT /colour=9 FT CDS 435242..435997 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0400" FT /note="Similar to Vibrio harveyi NADPH-flavin FT oxidoreductase Frp SW:FRP_VIBHA (Q56691) (240 aa) fasta FT scores: E(): 2.8e-28, 36.400% id in 250 aa, and to FT Bacillus subtilis nitro/flavin reductase NfrA FT SW:NFRA_BACSU (P39605) (249 aa) fasta scores: E(): 8e-37, FT 42.105% id in 247 aa" FT /product="nitroreductase family protein" FT misc_feature 435251..435760 FT /note="Pfam match to entry PF00881 Nitroreductase, FT Nitroreductase family, score 103.20, E-value 5e-27" FT /colour=9 FT CDS complement(436077..437465) FT /class="1.5.2" FT /colour=3 FT /locus_tag="SAR0401" FT /note="Similar to Escherichia coli proton glutamate FT symport protein GltP SW:GLTP_ECOLI (P21345) (437 aa) fasta FT scores: E(): 2.4e-22, 25.459% id in 436 aa, and to FT Bacillus subtilis hypothetical symporter YhcL FT SW:YHCL_BACSU (P54596) (463 aa) fasta scores: E(): FT 1.8e-102, 61.283% id in 452 aa" FT /product="putative sodium:dicarboxylate symporter protein" FT misc_feature complement(436140..437378) FT /note="Pfam match to entry PF00375 SDF, FT Sodium:dicarboxylate symporter family, score 282.80, FT E-value 4.5e-81" FT /colour=9 FT misc_feature complement(join(436218..436286,436296..436364,436608..436676,436734..436802,436860..436928,437085..437153,437187..437255,437298..437366,437403..437456)) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0401 by TMHMM2.0 at aa 4-21, 34-56, 71-93, 105-127, FT 180-202, 222-244, 264-286, 368-390 and 394-416" FT CDS 437550..437651 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0401a" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS complement(438408..438569) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0402" FT /note="No significant database matches. Doubtful CDS" FT /product="hypothetical protein" FT CDS complement(438584..439540) FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0403" FT /note="No significant database matches" FT /product="putative DNA-binding protein" FT misc_feature complement(439475..439540) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1266 FT (+3.50 SD) at aa 1-22, sequence MLTKEFAQRVELSEKQVRKIVQ" FT CDS complement(439658..440320) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0404" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(440463..440870) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0405" FT /note="No significant database matches" FT /product="hypothetical protein" FT misc_RNA 441050..441153 FT /note="Purine riboswitch as predicted by Rfam (RF00167), FT score 73.10" FT CDS 441383..441961 FT /EC_number="2.4.2.-" FT /class="3.3.11" FT /colour=7 FT /locus_tag="SAR0406" FT /gene="xpt" FT /note="Similar to Bacillus subtilis xanthine FT phosphoribosyltransferase Xpt SW:XPT_BACSU (P42085) (194 FT aa) fasta scores: E(): 1.5e-33, 53.403% id in 191 aa, and FT to Bacillus halodurans xanthine phosphoribosyltransferase FT BH1514 TR:Q9KCQ5 (EMBL:AP001512) (198 aa) fasta scores: FT E(): 3.5e-36, 50.785% id in 191 aa" FT /product="putative xanthine phosphoribosyltransferase" FT misc_feature 441449..441919 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 55.10, E-value FT 1.6e-12" FT /colour=9 FT CDS 441961..443229 FT /class="1.5.5" FT /colour=3 FT /locus_tag="SAR0407" FT /gene="pbuX" FT /note="Similar to Bacillus subtilis xanthine permease PbuX FT SW:PBUX_BACSU (P42086) (438 aa) fasta scores: E(): FT 4.8e-82, 56.532% id in 421 aa, and to Lactococcus lactis FT xanthine permease PbuX TR:Q9CGE9 (EMBL:AE006347) (434 aa) FT fasta scores: E(): 9.8e-71, 48.471% id in 425 aa" FT /product="putative xanthine permease" FT misc_feature 441961..443097 FT /note="Pfam match to entry PF00860 xan_ur_permease, FT Xanthine/uracil permeases family, score 421.50, E-value FT 7.6e-123" FT /colour=9 FT misc_feature join(441988..442047,442066..442125,442135..442203,442222..442281,442309..442377,442414..442473,442486..442545,442603..442671,442762..442830,442867..442935,442945..443013,443032..443100,443128..443196) FT /colour=0 FT /note="13 probable transmembrane helices predicted for FT SAR0407 by TMHMM2.0 at aa 10-29, 36-55, 59-81, 88-107, FT 117-139, 152-171, 176-195, 215-237, 268-290, 303-325, FT 329-351, 358-380 and 390-412" FT misc_feature 442933..442995 FT /colour=8 FT /note="PS01116 Xanthine/uracil permeases family FT signature." FT CDS 443267..444733 FT /EC_number="1.1.1.205" FT /class="3.7.1" FT /colour=7 FT /locus_tag="SAR0408" FT /gene="guaB" FT /gene="gnaB" FT /note="Similar to Bacillus subtilis FT inosine-5'-monophosphate dehydrogenase GuaB SW:IMDH_BACSU FT (P21879) (513 aa) fasta scores: E(): 1.1e-130, 76.923% id FT in 481 aa, and to Bacillus halodurans FT inositol-monophosphate dehydrogenase GuaB TR:Q9KGN8 FT (EMBL:AP001507) (485 aa) fasta scores: E(): 8.1e-130, FT 74.029% id in 489 aa" FT /product="putative inosine-5'-monophosphate dehydrogenase" FT misc_feature 443276..443539 FT /note="Pfam match to entry PF01574 IMPDH_N, IMP FT dehydrogenase / GMP reductase N terminus, score 195.60, FT E-value 7.9e-55" FT /colour=9 FT misc_feature 443543..443710 FT /note="Pfam match to entry PF00571 CBS, CBS domain, score FT 50.30, E-value 4.2e-11" FT /colour=9 FT misc_feature 443732..443890 FT /note="Pfam match to entry PF00571 CBS, CBS domain, score FT 57.10, E-value 3.7e-13" FT /colour=9 FT misc_feature 443978..444643 FT /note="Pfam match to entry PF00478 IMPDH_C, IMP FT dehydrogenase / GMP reductase C terminus, score 379.70, FT E-value 3e-110" FT /colour=9 FT misc_feature 444155..444193 FT /colour=8 FT /note="PS00487 IMP dehydrogenase / GMP reductase FT signature." FT CDS 444758..446299 FT /EC_number="6.3.5.2" FT /class="3.3.11" FT /colour=7 FT /locus_tag="SAR0409" FT /gene="guaA" FT /note="Similar to Bacillus subtilis GMP synthase FT [glutamine-hydrolyzing] GuaA SW:GUAA_BACSU (P29727) (513 FT aa) fasta scores: E(): 3.1e-153, 76.181% id in 508 aa, and FT to Bacillus halodurans putative GMP synthase FT [glutamine-hydrolyzing] GuaA SW:GUAA_BACHD (Q9KF78) (513 FT aa) fasta scores: E(): 3.5e-153, 73.541% id in 514 aa" FT /product="putative GMP synthase" FT misc_feature 444788..445333 FT /note="Pfam match to entry PF00117 GATase, Glutamine FT amidotransferase class-I, score 211.50, E-value 1.3e-59" FT /colour=9 FT misc_feature 445934..446293 FT /note="Pfam match to entry PF00958 GMP_synt_C, GMP FT synthase C terminal domain, score 238.30, E-value 1.1e-67" FT /colour=9 FT CDS complement(446829..447365) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0411" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(join(447757..448077,448079..448462)) FT /class="0.0.2" FT /colour=11 FT /locus_tag="SAR0412" FT /note="Poor database matches. Similar to Staphylococcus FT aureus subsp aureus N315 hypothetical protein SA0378 FT TR:Q99WI6 (EMBL:AP003130) (234 aa) fasta scores: E(): FT 4.9e-77, 98.291% id in 234 aa, and to Streptococcus FT pyogenes hypothetical P protein SPY0938 TR:Q9A043 FT (EMBL:AE006542) (269 aa) fasta scores: E(): 2.9e-07, FT 28.788% id in 264 aa. Contains a frameshift after codon FT 129. Frameshift occurs at a poly A octamer" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(448771..448947) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0414" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 448957..449082 FT /class="0.0.0" FT /colour=11 FT /locus_tag="SAR0414a" FT /note="Poor database matches. Similar to C-terminal region FT of Staphylococcus aureus mobile pathogenicity island FT protein Orf16 TR:Q9F0K2 (EMBL:AF217235) (105 aa) fasta FT scores: E(): 0.0018, 65.714% id in 35 aa" FT /partial FT /product="hypothetical protein (partial)" FT CDS join(449108..449227,449227..449295) FT /class="0.0.0" FT /colour=11 FT /locus_tag="SAR0415" FT /note="Poor database matches. Similar to an internal FT region of Staphylococcus aureus mobile pathogenicity FT island protein Orf13 TR:O54473 (EMBL:U93688) (95 aa) fasta FT scores: E(): 1e-05, 56.410% id in 39 aa. Contains a FT frameshift. Possible gene remnant. Similar to internal FT region of SAR0374 73.333% identity (73.333% ungapped) in FT 30 aa overlap" FT /partial FT /product="hypothetical protein (partial)" FT CDS complement(449607..449954) FT /class="5.1.4" FT /colour=11 FT /locus_tag="SAR0416" FT /note="Internal region is similar to Escherichia coli FT sequence element IS911b transposase InsN SW:INN2_ECOLI FT (P39212) (100 aa) fasta scores: E(): 0.022, 29.885% id in FT 87 aa, and to Bacillus halodurans transposase TR:Q9JWP9 FT (EMBL:AP001518) (94 aa) fasta scores: E(): 1.4e-14, FT 54.839% id in 93 aa. CDS does not contain a conventional FT translational start codon" FT /product="putative transposase (fragment)" FT /pseudo FT misc_feature complement(449796..449861) FT /colour=2 FT /note="Predicted helix-turn-helix motif for SAR0416 with FT score 1046.000, SD 2.75 at aa 32-53, sequence FT KPKNEIIREYDLTTSTFSNPIK" FT CDS complement(450191..450352) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0418" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(450752..450871) FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0419" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(450865..451224) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0420" FT /note="Similar to Lactococcus lactis hypothetical protein FT YtrP SW:YTRP_LACLA (Q02009) (119 aa) fasta scores: E(): FT 4e-19, 54.310% id in 116 aa, and to Neisseria meningitidis FT hypothetical protein NMB0528 TR:Q9K0Q6 (EMBL:AE002408) FT (123 aa) fasta scores: E(): 2.8e-08, 32.231% id in 121 aa" FT /product="putative membrane protein" FT misc_feature complement(join(450913..450981,451009..451077,451159..451215)) FT /colour=0 FT /note="3 probable transmembrane helices predicted for FT SAR0420 by TMHMM2.0 at aa 4-22, 50-72 and 82-104" FT CDS complement(451243..452088) FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0421" FT /note="Similar to Rhizobium loti hypothetical protein FT MLR1414 TR:BAB48794 (EMBL:AP002997) (297 aa) fasta scores: FT E(): 1e-15, 29.655% id in 290 aa, and to Escherichia coli FT hypothetical protein YtfG SW:YTFG_ECOLI (P39315) (286 aa) FT fasta scores: E(): 2e-15, 30.714% id in 280 aa" FT /product="conserved hypothetical protein" FT CDS 452560..453240 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0422" FT /note="Similar to Staphylococcus aureus exotoxin 3 Set3 FT TR:Q9ZFS6 (EMBL:AF094826) (234 aa) fasta scores: E(): FT 6.4e-29, 44.017% id in 234 aa, and to Staphylococcus FT aureus exotoxin 1 Set1 TR:Q9RN32 (EMBL:AF188837) (231 aa) FT fasta scores: E(): 3.4e-25, 40.773% id in 233 aa" FT /product="exotoxin" FT misc_feature 452560..452649 FT /note="Signal peptide predicted for SAR0422 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.992 between residues 30 and 31" FT /colour=6 FT CDS 453523..454224 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0423" FT /note="Similar to Staphylococcus aureus exotoxin 3 Set3 FT TR:Q9ZFS6 (EMBL:AF094826) (234 aa) fasta scores: E(): FT 3.2e-21, 38.819% id in 237 aa, and to Staphylococcus FT aureus exotoxin 1 Set1 TR:Q9RN32 (EMBL:AF188837) (231 aa) FT fasta scores: E(): 9.3e-23, 37.447% id in 235 aa" FT /product="exotoxin" FT misc_feature 453523..453612 FT /note="Signal peptide predicted for SAR0423 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.993 between residues 30 and 31" FT /colour=6 FT CDS 454512..455543 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0424" FT /note="C-terminal region is similar to Staphylococcus FT aureus exotoxin 3 Set3 TR:Q9ZFS6 (EMBL:AF094826) (234 aa) FT fasta scores: E(): 6.4e-13, 39.252% id in 214 aa, and to FT Staphylococcus aureus exotoxin 1 Set1 TR:Q9RN32 FT (EMBL:AF188837) (231 aa) fasta scores: E(): 2.7e-11, FT 34.404% id in 218 aa. Similar to SAR0425, 67.442% identity FT (76.066% ungapped) in 344 aa overlap. CDS contains inserts FT relative to SAR0425, residues 39 to 68 and 83 to 90" FT /product="exotoxin" FT misc_feature 454512..454601 FT /note="Signal peptide predicted for SAR0424 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.876 between residues 30 and 31" FT /colour=6 FT misc_feature 455241..455534 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score -0.80, E-value 0.0047" FT /colour=9 FT misc_feature 455319..455390 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 455890..456810 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0425" FT /note="C-terminal region is similar to Staphylococcus FT aureus exotoxin 3 Set3 TR:Q9ZFS6 (EMBL:AF094826) (234 aa) FT fasta scores: E(): 5.7e-11, 36.321% id in 212 aa, and to FT Staphylococcus aureus exotoxin 1 Set1 TR:Q9RN32 FT (EMBL:AF188837) (231 aa) fasta scores: E(): 1.2e-10, FT 35.780% id in 218 aa. Similar to SAR0424, 67.442% identity FT (76.066% ungapped) in 344 aa overlap" FT /product="exotoxin" FT misc_feature 455890..455979 FT /note="Signal peptide predicted for SAR0425 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.906 between residues 30 and 31" FT /colour=6 FT misc_feature 456496..456801 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score -12.10, E-value 0.041" FT /colour=9 FT misc_feature 456586..456657 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 456957..457082 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0426" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 457171..457875 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0427" FT /gene="set3" FT /note="Identical to Staphylococcus aureus exotoxin 3 Set3 FT TR:Q9ZFS6 (EMBL:AF094826) (234 aa) fasta scores: E(): FT 3e-86, 100.000% id in 234 a. Similar to Staphylococcus FT aureus exotoxin 4 Set4 TR:Q9ZFS3 (EMBL:AF094826) (227 aa) FT fasta scores: E(): 3.3e-27, 38.889% id in 234 aa" FT /product="exotoxin 3" FT misc_feature 457171..457260 FT /note="Signal peptide predicted for SAR0427 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.893 between residues 30 and 31" FT /colour=6 FT misc_feature 457585..457866 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score -22.20, E-value 0.27" FT /colour=9 FT misc_feature 457654..457725 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 458322..459017 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0428" FT /gene="set1" FT /note="Identical to Staphylococcus aureus exotoxin 1 Set1 FT TR:Q9ZFS5 (EMBL:AF094826) (231 aa) fasta scores: E(): FT 2.1e-81, 100.000% id in 231 aa. Similar to Staphylococcus FT aureus exotoxin 5 Set5 TR:Q9ZFS4 (EMBL:AF094826) (232 aa) FT fasta scores: E(): 2.5e-37, 52.586% id in 232 aa. Similar FT to SAR0429, 52.586% identity (53.275% ungapped) in 232 aa FT overlap" FT /product="exotoxin 1" FT misc_feature 458322..458411 FT /note="Signal peptide predicted for SAR0428 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.981 between residues 30 and 31" FT /colour=6 FT misc_feature 458700..459014 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score 12.10, E-value 0.00041" FT /colour=9 FT misc_feature 458790..458861 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 459358..460056 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0429" FT /gene="set5" FT /note="Identical to Staphylococcus aureus exotoxin 5 Set5 FT TR:Q9ZFS4 (EMBL:AF094826) (232 aa) fasta scores: E(): FT 7.6e-82, 100.000% id in 232 aa. Similar to Staphylococcus FT aureus exotoxin 1 Set1 TR:Q9RN33 (EMBL:AF188836) (231 aa) FT fasta scores: E(): 3.7e-38, 54.310% id in 232 aa. Similar FT to SAR0428, 52.586% identity (53.275% ungapped) in 232 aa FT overlap" FT /product="exotoxin 5" FT misc_feature 459358..459447 FT /note="Signal peptide predicted for SAR0429 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.830 between residues 30 and 31" FT /colour=6 FT misc_feature 459772..460053 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score 13.10, E-value 0.00034" FT /colour=9 FT misc_feature 459835..459906 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 460419..461102 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0431" FT /gene="set4" FT /note="Identical to Staphylococcus aureus exotoxin 4 Set4 FT TR:Q9ZFS3 (EMBL:AF094826) (227 aa) fasta scores: E(): FT 9.7e-85, 100.000% id in 227 aa. Similar to Staphylococcus FT aureus exotoxin 5 Set5 TR:Q9ZFS4 (EMBL:AF094826) (232 aa) FT fasta scores: E(): 9.6e-29, 47.414% id in 232 aa" FT /product="exotoxin 4" FT misc_feature 460419..460499 FT /note="Signal peptide predicted for SAR0431 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.995) with cleavage site FT probability 0.446 between residues 27 and 28" FT /colour=6 FT misc_feature 460785..461099 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score 0.70, E-value 0.0036" FT /colour=9 FT misc_feature 460881..460952 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 461180..461311 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0432" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 461364..462920 FT /EC_number="2.1.1.72" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0433" FT /note="Similar to Escherichia coli type I restriction FT enzyme EcoR124II modification protein HsdM SW:T1M1_ECOLI FT (P10484) (520 aa) fasta scores: E(): 1.8e-74, 42.578% id FT in 512 aa, and to Streptococcus thermophilus type I FT modification subunit HsdM TR:Q9RNW1 (EMBL:AF177167) (531 FT aa) fasta scores: E(): 1.1e-85, 49.031% id in 516 aa. FT Similar to SAR1899, 98.456% identity (98.456% ungapped) in FT 518 aa overlap" FT /product="putative type I restriction enzyme modification FT protein" FT misc_feature 461391..462131 FT /note="Pfam match to entry PF02506 Methylase_M, Type I FT restriction modification system, M protein, score 272.10, FT E-value 7.2e-78" FT /colour=9 FT misc_feature 462255..462275 FT /colour=8 FT /note="PS00092 N-6 Adenine-specific DNA methylases FT signature." FT misc_feature 462276..462761 FT /note="Pfam match to entry PF02384 N6_Mtase, N-6 DNA FT Methylase, score 262.00, E-value 8e-75" FT /colour=9 FT CDS 462913..464145 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0434" FT /note="Similar to Lactococcus lactis putative type I FT restriction and modification system specificity subunit FT HsdS TR:Q9AJ85 (EMBL:AF142640) (410 aa) fasta scores: E(): FT 1.7e-20, 26.545% id in 437 aa, and to Streptococcus FT thermophilus restriction modification system specificity FT subunit HsdS TR:Q9RNW6 (EMBL:AF177166) (419 aa) fasta FT scores: E(): 2.6e-09, 24.775% id in 444 aa" FT /product="putative restriction and modification system FT specificity protein" FT misc_feature 462973..463485 FT /note="Pfam match to entry PF01420 Methylase_S, Type I FT restriction modification DNA specificity domain, score FT 42.90, E-value 3.3e-11" FT /colour=9 FT misc_feature 463606..464067 FT /note="Pfam match to entry PF01420 Methylase_S, Type I FT restriction modification DNA specificity domain, score FT 23.60, E-value 1.2e-05" FT /colour=9 FT CDS 464528..465226 FT /class="5.1.5" FT /colour=0 FT /locus_tag="SAR0435" FT /note="Similar to Staphylococcus aureus exotoxin 3 Set3 FT TR:Q9ZFS6 (EMBL:AF094826) (234 aa) fasta scores: E(): FT 3.7e-32, 48.305% id in 236 aa, and to Staphylococcus FT aureus exotoxin 1 Set1 TR:Q9RN32 (EMBL:AF188837) (231 aa) FT fasta scores: E(): 2.1e-26, 43.404% id in 235 aa" FT /product="exotoxin" FT misc_feature 464528..464617 FT /note="Signal peptide predicted for SAR0435 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.994 between residues 30 and 31" FT /colour=6 FT misc_feature 464900..465223 FT /note="Pfam match to entry PF02876 Stap_Strp_tox_C, FT Staphylococcal/Streptococcal toxin, beta-grasp domain, FT score -3.90, E-value 0.0086" FT /colour=9 FT misc_feature 465005..465076 FT /colour=8 FT /note="PS00278 Staphyloccocal enterotoxin/Streptococcal FT pyrogenic exotoxin signature 2." FT CDS 465245..466732 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0436" FT /note="Poor database matches. Similar to Campylobacter FT jejuni hypothetical protein CJ0849c TR:Q9PP74 FT (EMBL:AL139076) (719 aa) fasta scores: E(): 0.28, 22.388% FT id in 402 aa, and to Saccharomyces cerevisiae FT intracellular protein transport protein Uso1 SW:USO1_YEAST FT (P25386) (1790 aa) fasta scores: E(): 2.2, 22.609% id in FT 460 aa" FT /product="putative exported protein" FT misc_feature 465245..465340 FT /note="Signal peptide predicted for SAR0436 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.684 between residues 32 and 33" FT /colour=6 FT CDS complement(466838..467146) FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0437" FT /note="No significant database matches" FT /product="putative exported protein" FT misc_feature complement(467060..467146) FT /note="Signal peptide predicted for SAR0437 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.780 between residues 29 and 30" FT /colour=6 FT CDS 467510..468295 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0438" FT /note="No significant database matches. Similar to FT SAR0439, 63.672% identity (63.922% ungapped) in 256 aa FT overlap, SAR0442, 63.118% identity (63.602% ungapped) in FT 263 aa overlap, SAR0443, 60.902% identity (62.548% FT ungapped) in 266 aa overlap, and SAR0444, 52.107% FT identity (52.918% ungapped) in 261 aa overlap" FT /product="putative lipoprotein" FT misc_feature 467510..467590 FT /note="Signal peptide predicted for SAR0438 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.966) with cleavage site FT probability 0.481 between residues 27 and 28" FT /colour=6 FT misc_feature 467528..467584 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0438 by TMHMM2.0 at aa 7-25" FT misc_feature 467549..467581 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 468343..469116 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0439" FT /note="No significant database matches. Similar to FT SAR0442, 78.210% identity (78.516% ungapped) in 257 aa FT overlap, SAR0443, 77.692% identity (78.906% ungapped) in FT 260 aa overlap, and SAR0438, 63.672% identity (63.922% FT ungapped) in 256 aa overlap" FT /product="putative lipoprotein" FT misc_feature 468343..468420 FT /note="Signal peptide predicted for SAR0439 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.919) with cleavage site FT probability 0.358 between residues 26 and 27" FT /colour=6 FT misc_feature 468361..468414 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0439 by TMHMM2.0 at aa 7-24" FT misc_feature 468379..468411 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS join(469147..469554,469554..469949) FT /class="4.1.7" FT /colour=11 FT /locus_tag="SAR0440" FT /note="No significant database matches. Contains a FT frameshift after codon 136. Similar to SAR0438, 72.61% FT identity in 248 aa overlap, SAR0442, 61.0% identity in 254 FT aa overlap, SAR0443, 61.0% identity in 254 aa overlap, and FT SAR0443, 67.3% identity in 254 aa overlap" FT /product="putative lipoprotein (pseudogene)" FT /pseudo FT misc_feature 469147..469245 FT /note="Signal peptide predicted for SAR0440 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.454 between residues 33 and 34" FT /colour=6 FT misc_feature 469183..469215 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 469987..470757 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0442" FT /note="No significant database matches. Similar to FT SAR0439, 78.210% identity (78.516% ungapped) in 257 aa FT overlap, SAR0443, 76.154% identity (77.647% ungapped) in FT 260 aa overlap, SAR0438, 63.118% identity (63.602% FT ungapped) in 263 aa overlap, and SAR0444, 56.757% identity FT (57.647% ungapped) in 259 aa overlap. Appears to have an FT uncleavable N-terminal signal sequence" FT /product="putative membrane protein" FT misc_feature 469987..470079 FT /note="Signal peptide predicted for SAR0442 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.994) with cleavage site FT probability 0.865 between residues 31 and 32" FT /colour=6 FT misc_feature 470005..470073 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0442 by TMHMM2.0 at aa 7-29" FT CDS 470789..471589 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0443" FT /note="No significant database matches. Similar to FT SAR0439, 77.692% identity (78.906% ungapped) in 260 aa FT overlap, SAR0442, 76.154% identity (77.647% ungapped) in FT 260 aa overlap, and SAR0438, 60.902% identity (62.548% FT ungapped) in 266 aa overlap" FT /product="putative lipoprotein" FT misc_feature 470789..470866 FT /note="Signal peptide predicted for SAR0443 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.811) with cleavage site FT probability 0.395 between residues 26 and 27" FT /colour=6 FT misc_feature 470807..470860 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0443 by TMHMM2.0 at aa 7-24" FT misc_feature 470825..470857 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 471608..472402 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0444" FT /note="No significant database matches. Similar to FT SAR2573, 64.314% identity (64.822% ungapped) in 255 aa FT overlap, SAR0106, 63.118% identity (65.613% ungapped) in FT 263 aa overlap, SAR2570, 61.923% identity (62.403% FT ungapped) in 260 aa overlap, SAR0445, 55.351% identity FT (57.034% ungapped) in 271 aa overlap, SAR0442, 56.757% FT identity (57.647% ungapped) in 259 aa overlap, SAR0438, FT 52.107% identity (52.918% ungapped) in 261 aa overlap, and FT SAR0443, 50.951% identity (52.344% ungapped) in 263 aa FT overlap" FT /product="putative lipoprotein" FT misc_feature 471608..471700 FT /note="Signal peptide predicted for SAR0444 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.989) with cleavage site FT probability 0.671 between residues 31 and 32" FT /colour=6 FT misc_feature 471644..471676 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 472568..473389 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0445" FT /note="No significant database matches. Similar to FT SAR0444, 55.351% identity (57.034% ungapped) in 271 aa FT overlap, SAR2573, 50.373% identity (52.326% ungapped) in FT 268 aa overlap, and SAR0106, 50.000% identity (53.571% FT ungapped) in 270 aa overlap" FT /product="putative lipoprotein" FT misc_feature 472586..472639 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0445 by TMHMM2.0 at aa 7-24" FT misc_feature 472607..472639 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS join(473382..473420,473420..474709) FT /note="Similar to Staphylococcus aureus hypothetical FT protein MW0402 SWALL:Q8NY34 (EMBL:AP004823) (441 aa) fasta FT scores: E(): 2.1e-133, 91.36% id in 440 aa, and to FT Staphylococcus aureus hypothetical protein MW0074 FT SWALL:Q8NYT9 (EMBL:AP004822) (458 aa) fasta scores: E(): FT 8.4e-29, 42.7% id in 459 aa. CDS contains a frameshift FT after codon 6. Frameshift possibly occurs at a poly A FT hexamer" FT /class="0.0.0" FT /colour=11 FT /locus_tag="SAR0446" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 474706..475029 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0447" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 475048..475362 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0448" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS complement(475651..475845) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0449" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature complement(join(475678..475746,475783..475836)) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0449 by TMHMM2.0 at aa 4-21 and 34-56" FT misc_feature complement(475762..475845) FT /note="Signal peptide predicted for SAR0449 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.898) with cleavage site FT probability 0.314 between residues 28 and 29" FT /colour=6 FT CDS 476030..477232 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0450" FT /note="Similar to Pseudomonas chlororaphis hypothetical FT protein, needed for nitrile hydratase expression FT SW:P47K_PSECL (P31521) (419 aa) fasta scores: E(): FT 1.2e-55, 43.142% id in 401 aa, and to Bacillus subtilis FT hypothetical protein YciC TR:P94400 (EMBL:D50453) (397 aa) FT fasta scores: E(): 1.9e-100, 67.424% id in 396 aa" FT /product="putative cobalamin synthesis protein" FT misc_feature 476060..476083 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 476132..477106 FT /note="Pfam match to entry PF02492 cobW, Cobalamin FT synthesis protein/P47K, score 426.10, E-value 3.1e-124" FT /colour=9 FT CDS 477501..477629 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0451" FT /note="No significant database matches" FT /product="hypothetical protein" FT CDS 478818..480302 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0452" FT /note="Similar to Bacillus subtilis NADH dehydrogenase FT subunit 5 NdhF SW:NDHF_BACSU (P39755) (505 aa) fasta FT scores: E(): 7.5e-96, 51.594% id in 502 aa, and to Vibrio FT cholerae putative NADH dehydrogenase VC1581 TR:Q9KRQ5 FT (EMBL:AE004235) (516 aa) fasta scores: E(): 2.2e-25, FT 27.349% id in 479 aa" FT /product="putative NADH-Ubiquinone/plastoquinone (complex FT I) protein" FT misc_feature 478818..478895 FT /note="Signal peptide predicted for SAR0452 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.983) with cleavage site FT probability 0.396 between residues 26 and 27" FT /colour=6 FT misc_feature join(478836..478904,478917..478985,479022..479075,479118..479171,479190..479243,479286..479354,479388..479456,479499..479558,479577..479645,479688..479756,479844..479912,479922..479975,480009..480077,480120..480188) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0452 by TMHMM2.0 at aa 7-29, 34-56, 69-86, 101-118, FT 125-142, 157-179, 191-213, 228-247, 254-276, 291-313, FT 343-365, 369-386, 398-420 and 435-457" FT misc_feature 479172..479816 FT /note="Pfam match to entry PF00361 oxidored_q1, FT NADH-Ubiquinone/plastoquinone (complex I), various chains, FT score 172.80, E-value 5.8e-48" FT /colour=9 FT CDS 480315..483020 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0453" FT /note="Similar to Aquifex aeolicus hypothetical protein FT AG_863 TR:O67026 (EMBL:AE000711) (1007 aa) fasta scores: FT E(): 2.9e-42, 27.685% id in 1015 aa, and an internal FT region of Bacillus subtilis hypothetical protein YbcD FT TR:O87092 (EMBL:AB006424) (686 aa) fasta scores: E(): FT 7.8e-94, 46.501% id in 686 aa" FT /product="hypothetical protein" FT CDS 483182..483544 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0454" FT /note="Similar to Bacillus subtilis hypothetical protein FT YbcI TR:O34380 (EMBL:Z99104) (124 aa) fasta scores: E(): FT 7.6e-32, 70.000% id in 120 aa, and to Bacillus halodurans FT hypothetical protein BH3870 TR:Q9K662 (EMBL:AP001520) (121 FT aa) fasta scores: E(): 3.8e-30, 66.387% id in 119 aa" FT /product="conserved hypothetical protein" FT CDS complement(483773..484120) FT /note="Poor database matches. C-terminal region is similar FT to Staphylococcus aureus hypothetical protein SAV0455 or FT SA0414 SWALL:Q99WE7 (EMBL:AP003359) (80 aa) fasta scores: FT E(): 1.7e-29, 98.75% id in 80 aa. Possible alternative FT translational start site" FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0455" FT /product="putative membrane protein" FT misc_feature complement(join(483791..483859,483872..483931,483959..484015,484034..484093)) FT /colour=0 FT /note="4 probable transmembrane helices predicted for FT SAR0455 by TMHMM2.0 at aa 10-29, 36-54, 64-83 and 88-110" FT CDS 484227..484901 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0456" FT /note="Similar to Helicobacter pylori J99 hypothetical FT protein JHP0787 TR:Q9ZKZ5 (EMBL:AE001509) (228 aa) fasta FT scores: E(): 6.9e-13, 29.767% id in 215 aa, and to FT Bacillus megaterium hypothetical protein TR:Q06074 FT (EMBL:Z21972) (216 aa) fasta scores: E(): 2.1e-10, 26.244% FT id in 221 aa" FT /product="putative membrane protein" FT misc_feature 484227..484313 FT /note="Signal peptide predicted for SAR0456 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.887) with cleavage site FT probability 0.558 between residues 29 and 30" FT /colour=6 FT misc_feature join(484263..484322,484446..484505,484518..484574,484656..484709,484728..484796,484809..484877) FT /colour=0 FT /note="6 probable transmembrane helices predicted for FT SAR0456 by TMHMM2.0 at aa 13-32, 74-93, 98-116, 144-161, FT 168-190 and 195-217" FT misc_feature 484449..484877 FT /note="Pfam match to entry PF01569 PAP2, PAP2 superfamily, FT score 59.40, E-value 7.6e-14" FT /colour=9 FT CDS 484938..485672 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0457" FT /note="Similar to Bacillus stearothermophilus FT carboxylesterase precursor Est SW:EST_BACST (Q06174) (247 FT aa) fasta scores: E(): 1.3e-22, 31.020% id in 245 aa, and FT to Bacillus subtilis hypothetical protein YvaK TR:O32232 FT (EMBL:Z99121) (248 aa) fasta scores: E(): 2e-24, 31.837% FT id in 245 aa" FT /product="conserved hypothetical protein" FT CDS 485874..485963 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0457a" FT /note="Doubtful CDS. No database matches" FT /product="hypothetical protein" FT CDS 486126..487466 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0458" FT /note="Similar to Bacillus subtilis putative transporter FT YocR TR:O34383 (EMBL:AF027868) (445 aa) fasta scores: E(): FT 1.8e-73, 49.103% id in 446 aa, and to Bacillus halodurans FT sodium-dependent transporter BH0217 TR:Q9KG95 FT (EMBL:AP001507) (457 aa) fasta scores: E(): 1.1e-67, FT 46.727% id in 443 aa" FT /product="sodium:neurotransmitter symporter family FT protein" FT misc_feature 486126..486194 FT /note="Signal peptide predicted for SAR0458 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.730) with cleavage site FT probability 0.246 between residues 23 and 24" FT /colour=6 FT misc_feature 486147..486326 FT /note="Pfam match to entry PF00209 SNF, FT Sodium:neurotransmitter symporter family, score 43.40, FT E-value 3.6e-11" FT /colour=9 FT misc_feature join(486162..486215,486258..486326,486405..486473,486555..486623,486660..486719,486777..486845,486882..486950,487032..487100,487155..487223,487266..487334,487392..487460) FT /colour=0 FT /note="11 probable transmembrane helices predicted for FT SAR0458 by TMHMM2.0 at aa 13-30, 45-67, 94-116, 144-166, FT 179-198, 218-240, 253-275, 303-325, 344-366, 381-403 and FT 423-445" FT misc_feature 486618..487106 FT /note="Pfam match to entry PF00209 SNF, FT Sodium:neurotransmitter symporter family, score 59.50, FT E-value 1.4e-15" FT /colour=9 FT CDS 487683..488588 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0459" FT /note="Similar to Bacillus subtilis putative cysteine FT synthase YrhA TR:O05393 (EMBL:U93874) (307 aa) fasta FT scores: E(): 2.4e-51, 51.864% id in 295 aa, and to FT Helicobacter pylori putative cysteine synthase HP0107 FT SW:CYSM_HELPY (P56067) (306 aa) fasta scores: E(): FT 4.7e-47, 48.993% id in 298 aa" FT /product="pyridoxal-phosphate dependent enzyme" FT misc_feature 487689..488531 FT /note="Pfam match to entry PF00291 PALP, FT Pyridoxal-phosphate dependent enzyme, score 298.60, FT E-value 7.5e-86" FT /colour=9 FT misc_feature 487764..487820 FT /colour=8 FT /note="PS00901 Cysteine synthase/cystathionine FT beta-synthase P-phosphate attachment site." FT CDS 488581..489723 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0460" FT /note="Similar to Bacillus subtilis putative cystathionine FT gamma-lyase YrhB TR:O05394 (EMBL:U93874) (379 aa) fasta FT scores: E(): 7.2e-82, 57.632% id in 380 aa, and to FT Helicobacter pylori putative cystathionine gamma-synthase FT HP0106 SW:METB_HELPY (P56069) (380 aa) fasta scores: E(): FT 2.3e-76, 53.846% id in 377 aa" FT /product="putative Cys/Met metabolism PLP-dependent FT enzyme" FT misc_feature 488590..489714 FT /note="Pfam match to entry PF01053 Cys_Met_Meta_PP, FT Cys/Met metabolism PLP-dependent enzyme, score 662.80, FT E-value 1.7e-195" FT /colour=9 FT misc_feature 489142..489186 FT /colour=8 FT /note="PS00868 Cys/Met metabolism enzymes FT pyridoxal-phosphate attachment site." FT CDS 490014..491039 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0461" FT /note="Similar to Escherichia coli probable ATP-binding FT component of a transporter system Abc SW:ABC_ECOLI FT (P30750) (343 aa) fasta scores: E(): 1.7e-48, 46.313% id FT in 339 aa, and to Vibrio cholerae ABC transporter, FT ATP-binding protein VC0907 TR:Q9KTJ5 (EMBL:AE004174) (344 FT aa) fasta scores: E(): 6.8e-49, 46.313% id in 339 aa" FT /product="ABC transporter ATP-binding protein" FT misc_feature 490104..490664 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 227.20, E-value 2.4e-64" FT /colour=9 FT misc_feature 490125..490148 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 490434..490478 FT /colour=8 FT /note="PS00211 ABC transporters family signature." FT CDS 491043..491702 FT /class="1.5.0" FT /colour=3 FT /locus_tag="SAR0462" FT /note="Similar to Salmonella enteritidis pathogenicity FT islet encoded integral membrane protein SfbC TR:Q9S4Y9 FT (EMBL:AF102556) (202 aa) fasta scores: E(): 2e-30, 48.969% FT id in 194 aa, and to Vibrio cholerae ABC transporter, FT permease protein VC0906 TR:Q9KTJ6 (EMBL:AE004174) (225 aa) FT fasta scores: E(): 5.7e-38, 51.659% id in 211 aa. CDS FT contains extra residues at the N-terminus in comparison to FT the S. enteritidis protein" FT /product="putative transport system membrane protein" FT misc_feature join(491100..491168,491226..491279,491289..491357,491484..491552,491610..491678) FT /colour=0 FT /note="5 probable transmembrane helices predicted for FT SAR0462 by TMHMM2.0 at aa 20-42, 62-79, 83-105, 148-170 FT and 190-212" FT misc_feature 491379..491591 FT /note="Pfam match to entry PF00528 BPD_transp, FT Binding-protein-dependent transport systems inner membrane FT component, score 52.50, E-value 9.6e-12" FT /colour=9 FT misc_feature 491382..491468 FT /colour=8 FT /note="PS00402 Binding-protein-dependent transport systems FT inner membrane comp. sign." FT CDS 491739..492581 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0463" FT /note="Similar to Pasteurella haemolytica outer membrane FT lipoprotein 3 precursor PlpC SW:PLPC_PASHA (Q08870) (263 FT aa) fasta scores: E(): 1.8e-25, 38.846% id in 260 aa, and FT to Lactococcus lactis outer membrane lipoprotein precursor FT PlpB TR:Q9CIN7 (EMBL:AE006269) (286 aa) fasta scores: E(): FT 7.2e-31, 42.751% id in 269 aa" FT /product="putative lipoprotein" FT misc_feature 491739..491813 FT /note="Signal peptide predicted for SAR0463 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.999) with cleavage site FT probability 0.271 between residues 25 and 26" FT /colour=6 FT misc_feature 491760..491792 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT CDS 492915..493919 FT /class="4.1.7" FT /colour=3 FT /locus_tag="SAR0464" FT /note="Similar to an internal region of Enterococcus FT faecalis autolysin precursor SW:ALYS_ENTFA (P37710) (671 FT aa) fasta scores: E(): 2.5e-18, 31.970% id in 269 aa, and FT to the C-terminal region of Bacillus subtilis FT endopeptidase precursor LytF TR:O07532 (EMBL:Y14079) (488 FT aa) fasta scores: E(): 1.4e-20, 34.591% id in 318 aa" FT /product="putative exported protein" FT misc_feature 492915..492989 FT /note="Signal peptide predicted for SAR0464 by SignalP 2.0 FT HMM (Signal peptide probabilty 1.000) with cleavage site FT probability 0.995 between residues 25 and 26" FT /colour=6 FT misc_feature 492999..493127 FT /note="Pfam match to entry PF01476 LysM, LysM domain, FT score 73.30, E-value 5e-18" FT /colour=9 FT misc_feature 493191..493319 FT /note="Pfam match to entry PF01476 LysM, LysM domain, FT score 70.60, E-value 3.2e-17" FT /colour=9 FT misc_feature 493392..493520 FT /note="Pfam match to entry PF01476 LysM, LysM domain, FT score 70.30, E-value 4.1e-17" FT /colour=9 FT CDS complement(494106..494375) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0465" FT /note="No significant database matches" FT /product="putative membrane protein" FT misc_feature complement(494211..494270) FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0465 by TMHMM2.0 at aa 36-55" FT CDS 494516..494920 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0466" FT /note="Poor database matches. Similar to the N-terminal FT regions of Pseudomonas aeruginosa hypothetical protein FT PA3470 TR:Q9HYD6 (EMBL:AE004768) (152 aa) fasta scores: FT E(): 0.00013, 29.524% id in 105 aa, and to Streptococcus FT pneumoniae hypothetical protein TR:Q9K2H0 (EMBL:AF154045) FT (212 aa) fasta scores: E(): 0.0026, 30.275% id in 109 aa" FT /product="MutT domain containing protein" FT misc_feature 494522..494908 FT /note="Pfam match to entry PF00293 NUDIX, MutT-like FT domain, score 47.30, E-value 3.4e-10" FT /colour=9 FT misc_feature 494615..494674 FT /colour=8 FT /note="PS00893 mutT domain signature." FT CDS 494910..495395 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0467" FT /note="Similar to Bacillus subtilis spermine/spermidine FT acetyltransferase BltD SW:BLTD_BACSU (P39909) (152 aa) FT fasta scores: E(): 0.0021, 21.154% id in 156 aa, and to FT Bacillus halodurans hypothetical protein BH3804 TR:Q9K6C5 FT (EMBL:AP001520) (167 aa) fasta scores: E(): 2.1e-10, FT 31.159% id in 138 aa. Possible alternative translational FT start site" FT /product="putative acetyltransferase" FT misc_feature 495063..495332 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 42.90, E-value FT 7.3e-09" FT /colour=9 FT CDS complement(495564..496346) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0468" FT /note="Similar to Lactococcus lactis hypothetical protein FT YibF TR:Q9CHC4 (EMBL:AE006314) (253 aa) fasta scores: E(): FT 4.4e-18, 26.172% id in 256 aa, and to an internal region FT of Streptomyces coelicolor putative membrane protein FT SCQ11.10c TR:Q9X9U1 (EMBL:AL096823) (513 aa) fasta scores: FT E(): 4.7e-14, 25.200% id in 250 aa" FT /product="putative membrane protein" FT misc_feature complement(join(495615..495683,495741..495809,495933..496001,496044..496112,496131..496199,496209..496277,496290..496337)) FT /colour=0 FT /note="7 probable transmembrane helices predicted for FT SAR0468 by TMHMM2.0 at aa 4-19, 24-46, 50-72, 79-101, FT 116-138, 180-202 and 222-244" FT misc_feature complement(496287..496346) FT /note="Signal peptide predicted for SAR0468 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.639) with cleavage site FT probability 0.370 between residues 20 and 21" FT /colour=6 FT CDS complement(496343..497461) FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0469" FT /note="Similar to Lactococcus lactis hypothetical protein FT YibE TR:Q9CHC5 (EMBL:AE006314) (393 aa) fasta scores: E(): FT 3.1e-24, 30.303% id in 363 aa, and to an internal region FT of Streptomyces coelicolor putative membrane protein FT SCQ11.10c TR:Q9X9U1 (EMBL:AL096823) (513 aa) fasta scores: FT E(): 8.5e-12, 26.102% id in 295 aa" FT /product="putative membrane protein" FT misc_feature complement(join(496370..496438,496496..496564,496652..496720,496784..496852,496871..496939,496952..497011,497030..497083,497366..497425)) FT /colour=0 FT /note="8 probable transmembrane helices predicted for FT SAR0469 by TMHMM2.0 at aa 13-32, 127-144, 151-170, FT 175-197, 204-226, 248-270, 300-322 and 342-364" FT misc_feature complement(497345..497461) FT /note="Signal peptide predicted for SAR0469 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.980) with cleavage site FT probability 0.295 between residues 39 and 40" FT /colour=6 FT CDS complement(497576..498460) FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0470" FT /note="Similar to Bacillus subtilis glutamate biosynthesis FT transcriptional regulatory protein GltC SW:GLTC_BACSU FT (P20668) (300 aa) fasta scores: E(): 1.3e-14, 29.900% id FT in 301 aa. N-terminus is similar to the N-terminal region FT of Acinetobacter calcoaceticus cat operon transcriptional FT regulator CatM SW:CATM_ACICA (P07774) (303 aa) fasta FT scores: E(): 5.1e-12, 30.364% id in 247 aa" FT /product="LysR family regulatory protein" FT misc_feature complement(498029..498454) FT /note="Pfam match to entry PF00126 HTH_1, Bacterial FT regulatory helix-turn-helix protein, lysR family, score FT 113.80, E-value 3.2e-30" FT /colour=9 FT misc_feature complement(498320..498412) FT /colour=8 FT /note="PS00044 Bacterial regulatory proteins, lysR family FT signature." FT misc_feature complement(498350..498415) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 1683 FT (+4.92 SD) at aa 16-37, sequence EHISETALELNIAQSAISRQIT" FT CDS 498641..503140 FT /EC_number="1.4.1.13" FT /class="3.1.07" FT /colour=7 FT /locus_tag="SAR0471" FT /gene="gltA" FT /note="Similar to Bacillus subtilis glutamate synthase FT [NADPH], large subunit protein GltB SW:GLTB_BACSU (P39812) FT (1520 aa) fasta scores: E(): 0, 53.329% id in 1517 aa, and FT to Campylobacter jejuni glutamate synthase protein GltB FT TR:Q9PJA4 (EMBL:AL139074) (1496 aa) fasta scores: E(): 0, FT 47.641% id in 1505 aa" FT /product="glutamate synthase, large subunit" FT misc_feature 500996..502099 FT /note="Pfam match to entry PF01645 Glu_synthase, Conserved FT region in glutamate synthase, score 757.60, E-value FT 5.3e-224" FT /colour=9 FT misc_feature 502322..502906 FT /note="Pfam match to entry PF01493 DUF14, Domain of FT unknown function DUF14, score 219.10, E-value 6.5e-62" FT /colour=9 FT CDS 503158..504621 FT /class="3.1.07" FT /colour=7 FT /locus_tag="SAR0472" FT /gene="gltB" FT /note="Similar to an internal region of Saccharomyces FT cerevisiae glutamate synthase [NADPH] precursor GLT1 FT SW:GLT1_YEAST (Q12680) (2144 aa) fasta scores: E(): FT 3.1e-71, 41.770% id in 486 aa. Full length CDS is similar FT to Bacillus subtilis glutamate synthase GltB TR:O34399 FT (EMBL:Z99113) (493 aa) fasta scores: E(): 3.7e-97, 53.893% FT id in 488 aa" FT /product="glutamate synthase, small subunit" FT misc_feature 503617..504552 FT /note="Pfam match to entry PF00070 pyr_redox, Pyridine FT nucleotide-disulphide oxidoreductase, score 72.70, E-value FT 7.9e-18" FT /colour=9 FT tRNA 504894..504986 FT /note="tRNA Ser anticodon TGA, Cove score 69.34" FT CDS 505439..506866 FT /class="1.5.3" FT /colour=3 FT /locus_tag="SAR0473" FT /note="Similar to Staphylococcus xylosus PTS system, FT sucrose-specific IIBC component ScrA SW:PTSB_STAXY FT (P51184) (480 aa) fasta scores: E(): 1.5e-74, 46.653% id FT in 478 aa, and to Bacillus halodurans PTS system, FT trehalose-specific enzyme IIBC component BH2216 TR:Q9KAS1 FT (EMBL:AP001514) (470 aa) fasta scores: E(): 8.2e-91, FT 54.873% id in 472 aa" FT /product="sugar-specific PTS transport system, IIBC FT component" FT misc_feature 505460..505564 FT /note="Pfam match to entry PF00367 PTS_EIIB, FT phosphotransferase system, EIIB, score 67.30, E-value FT 6.3e-18" FT /colour=9 FT misc_feature 505496..505549 FT /colour=8 FT /note="PS01035 PTS EIIB domains cysteine phosphorylation FT site signature." FT misc_feature 505766..506662 FT /note="Pfam match to entry PF02378 PTS_EIIC, FT Phosphotransferase system, EIIC, score 156.60, E-value FT 4.3e-43" FT /colour=9 FT misc_feature join(505775..505843,505901..505960,505979..506047,506234..506302,506339..506407,506450..506518,506555..506623,506636..506704,506753..506821) FT /colour=0 FT /note="9 probable transmembrane helices predicted for FT SAR0473 by TMHMM2.0 at aa 113-135, 155-174, 181-203, FT 266-288, 301-323, 338-360, 373-395, 400-422 and 439-461" FT CDS 506930..508570 FT /class="2.1.3" FT /colour=5 FT /locus_tag="SAR0474" FT /note="Similar to Bacillus subtilis trehalose-6-phosphate FT hydrolase TreA SW:TREC_BACSU (P39795) (561 aa) fasta FT scores: E(): 1.8e-132, 59.538% id in 519 aa, and to FT Escherichia coli trehalose-6-phosphate hydrolase TreC FT SW:TREC_ECOLI (P28904) (551 aa) fasta scores: E(): FT 1.5e-119, 56.660% id in 503 aa" FT /product="putative glycosyl hydrolase" FT misc_feature 506972..508171 FT /note="Pfam match to entry PF00128 alpha-amylase, Alpha FT amylase, catalytic domain, score 452.20, E-value 4.5e-132" FT /colour=9 FT CDS 508595..509323 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0475" FT /note="Similar to Bacillus subtilis trehalose operon FT transcriptional repressor TreR SW:TRER_BACSU (P39796) (238 FT aa) fasta scores: E(): 4e-26, 39.076% id in 238 aa, and to FT Bacillus halodurans trehalose operon transcriptional FT repressor TreR TR:Q9KEH9 (EMBL:AP001510) (237 aa) fasta FT scores: E(): 2e-26, 38.889% id in 234 aa" FT /product="GntR family regulatory protein" FT misc_feature 508622..508801 FT /note="Pfam match to entry PF00392 gntR, Bacterial FT regulatory proteins, gntR family, score 58.40, E-value FT 1.7e-16" FT /colour=9 FT misc_RNA 509502..509604 FT /note="Small cytoplasmic RNA (scRNA, 4.5S RNA), signal FT recognition particle (SRP) as predicted by Rfam (RF00169), FT score 77.94" FT CDS 509760..509825 FT /class="0.0.0" FT /colour=8 FT /locus_tag="SAR0475a" FT /note="Doubtful CDS. No database matches" FT /product="hypothetical protein" FT CDS 509964..510488 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0476" FT /note="Similar to Lactococcus lactis hypothetical protein FT YafC TR:Q9CJE1 (EMBL:AE006244) (173 aa) fasta scores: E(): FT 9.5e-11, 28.902% id in 173 aa, and to Escherichia coli FT hypothetical protein YhbS SW:YHBS_ECOLI (P45473) (167 aa) FT fasta scores: E(): 4.1e-05, 27.972% id in 143 aa" FT /product="acetyltransferase (GNAT) family protein" FT misc_feature 510123..510365 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 46.70, E-value FT 5.2e-10" FT /colour=9 FT CDS 510557..512254 FT /EC_number="2.7.7.7" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0477" FT /gene="dnaX" FT /gene="dnaZX" FT /note="N-terminus is similar to the N-terminal region of FT Escherichia coli DNA polymerase III, tau subunit protein FT DnaX SW:DP3X_ECOLI (P06710) (643 aa) fasta scores: E(): FT 8.3e-40, 36.404% id in 456 aa. Full length CDS is similar FT to Bacillus subtilis DNA polymerase III subunit gamma/tau FT DnaX SW:DP3X_BACSU (P09122) (563 aa) fasta scores: E(): FT 4e-80, 46.034% id in 580 aa" FT /product="DNA polymerase III, tau subunit" FT misc_feature 510674..511246 FT /note="Pfam match to entry PF00004 AAA, ATPase family FT associated with various cellular activities (AAA), score FT 43.50, E-value 4.7e-09" FT /colour=9 FT misc_feature 510689..510712 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 510773..510790 FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signature." FT misc_feature 511541..511594 FT /colour=8 FT /note="PS00214 Cytosolic fatty-acid binding proteins FT signature." FT CDS 512344..512661 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0478" FT /note="Similar to Bacillus subtilis hypothetical protein FT YaaK SW:YAAK_BACSU (P24281) (107 aa) fasta scores: E(): FT 1.9e-22, 66.981% id in 106 aa, and to Bacillus halodurans FT hypothetical protein BH0035 SW:Y035_BACHD (Q9JWQ5) (103 FT aa) fasta scores: E(): 1.2e-20, 64.000% id in 100 aa" FT /product="conserved hypothetical protein" FT misc_feature 512347..512637 FT /note="Pfam match to entry PF02575 DUF149, Uncharacterized FT BCR, YbaB family COG0718, score 128.50, E-value 1.2e-34" FT /colour=9 FT CDS 512668..513264 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0479" FT /gene="recR" FT /gene="recM" FT /gene="recD" FT /note="Similar to Bacillus subtilis recombination protein FT RecR SW:RECR_BACSU (P24277) (198 aa) fasta scores: E(): FT 1.7e-58, 76.768% id in 198 aa, and to Bacillus halodurans FT DNA repair and genetic recombination protein RecR FT TR:Q9KGM3 (EMBL:AP001507) (198 aa) fasta scores: E(): FT 3.9e-57, 75.253% id in 198 aa" FT /product="putative recombination protein" FT misc_feature 512779..512904 FT /note="Pfam match to entry PF02132 RecR, RecR protein, FT score 75.40, E-value 1.2e-18" FT /colour=9 FT misc_feature 512836..512898 FT /colour=8 FT /note="PS01300 RecR protein signature." FT misc_feature 512905..513186 FT /note="Pfam match to entry PF01751 Toprim, Toprim domain, FT score 61.60, E-value 1.7e-14" FT /colour=9 FT rRNA 514251..515805 FT /note="16S rRNA" FT rRNA 516229..519151 FT /note="23S rRNA" FT rRNA 519224..519338 FT /note="5S rRNA" FT misc_feature complement(519368..520324) FT /note="Putative insertion sequence ISY" FT /colour=0 FT /label=ISY FT CDS complement(519424..520212) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0480" FT /note="Similar to C-terminal region of Enterococcus FT faecium transposase TR:Q47815 (EMBL:L40841) (310 aa) fasta FT scores: E(): 1.9e-39, 46.183% id in 262 aa, and to the FT full length Neisseria gonorrhoeae hypothetical protein FT TR:Q50996 (EMBL:L36381) (267 aa) fasta scores: E(): FT 1.1e-27, 39.689% id in 257 aa" FT /product="putative insertion element protein" FT misc_feature complement(519451..519900) FT /note="Pfam match to entry PF00665 rve, Integrase core FT domain, score 95.20, E-value 2.4e-26" FT /colour=9 FT CDS complement(520236..520991) FT /class="5.1.4" FT /colour=12 FT /locus_tag="SAR0481" FT /note="C-terminal is similar to Lactobacillus johnsonii FT insertion element IS1223 hypothetical protein FT SW:YI3A_LACJO (Q48585) (177 aa) fasta scores: E(): FT 2.7e-08, 33.140% id in 172 aa, and Lactococcus lactis FT hypothetical protein YgcE TR:O32786 (EMBL:X92946) (185 aa) FT fasta scores: E(): 7.2e-06, 26.404% id in 178 aa. Possible FT alternative translational start site" FT /product="putative insertion element protein" FT misc_feature complement(520290..520586) FT /note="Pfam match to entry PF01527 Transposase_8, FT Transposase, score 47.20, E-value 3.6e-10" FT /colour=9 FT misc_feature complement(520325..521024) FT /note="Putative insertion sequence ISZ" FT /colour=0 FT /label=ISZ FT misc_feature complement(520464..520529) FT /colour=2 FT /note="Predicted helix-turn-helix motif with score 2127 FT (+6.43 SD) at aa 155-176, sequence QSYREVAEHFNISYGQIYQWVH" FT CDS 521423..522760 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0482" FT /note="Similar to Bacillus subtilis hypothetical protein FT YaaO SW:YAAO_BACSU (P37536) (480 aa) fasta scores: E(): FT 3.4e-27, 35.908% id in 479 aa, and to Bacillus halodurans FT putative lysine decarboxylase BH0041 TR:Q9KGM0 FT (EMBL:AP001507) (482 aa) fasta scores: E(): 2.4e-21, FT 33.766% id in 462 aa" FT /product="Orn/Lys/Arg decarboxylase family protein" FT misc_feature 521864..522193 FT /note="Pfam match to entry PF01276 OKR_DC_1, Orn/Lys/Arg FT decarboxylase, score 76.20, E-value 1.3e-20" FT /colour=9 FT CDS 522762..523379 FT /EC_number="2.7.4.9" FT /class="3.3.17" FT /colour=7 FT /locus_tag="SAR0483" FT /gene="tmk" FT /note="Similar to Yersinia pestis thymidylate kinase Tmk FT SW:KTHY_YERPE (O69169) (212 aa) fasta scores: E(): 3e-16, FT 37.019% id in 208 aa, and to Bacillus subtilis thymidylate FT kinase Tmk SW:KTHY_BACSU (P37537) (212 aa) fasta scores: FT E(): 1.3e-34, 53.398% id in 206 aa" FT /product="putative thymidylate kinase" FT misc_feature 522780..523343 FT /note="Pfam match to entry PF02223 Thymidylate_kin, FT Thymidylate kinase, score 217.80, E-value 1.6e-61" FT /colour=9 FT misc_feature 522786..522809 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 523026..523064 FT /colour=8 FT /note="PS01331 Thymidylate kinase signature." FT CDS 523407..523736 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0484" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH0043 TR:Q9KGL8 (EMBL:AP001507) (109 aa) fasta scores: FT E(): 8e-29, 66.055% id in 109 aa, and to Bacillus subtilis FT hypothetical protein YaaQ SW:YAAQ_BACSU (P37538) (109 aa) FT fasta scores: E(): 9.7e-28, 65.138% id in 109 aa" FT /product="conserved hypothetical protein" FT CDS 523950..524876 FT /EC_number="2.7.7.7" FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0485" FT /gene="holB" FT /note="Similar to Bacillus subtilis DNA polymerase III, FT delta' subunit protein HolB SW:HOLB_BACSU (P37540) (329 FT aa) fasta scores: E(): 3.3e-25, 31.699% id in 306 aa, and FT to Bacillus halodurans DNA polymerase III delta' subunit FT HolB TR:Q9KGL7 (EMBL:AP001507) (328 aa) fasta scores: E(): FT 9.1e-23, 30.421% id in 309 aa" FT /product="putative DNA polymerase III, delta' subunit" FT CDS 524877..525680 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0486" FT /note="Similar to Bacillus subtilis hypothetical protein FT YaaT SW:YAAT_BACSU (P37541) (275 aa) fasta scores: E(): FT 1.7e-62, 63.019% id in 265 aa, and to Bacillus halodurans FT signal peptidase-like protein BH0045 TR:Q9KGL6 FT (EMBL:AP001507) (275 aa) fasta scores: E(): 7.6e-60, FT 59.696% id in 263 aa" FT /product="conserved hypothetical protein" FT CDS 525697..526044 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0487" FT /note="Similar to Bacillus halodurans hypothetical protein FT BH0046 TR:Q9KGL5 (EMBL:AP001507) (116 aa) fasta scores: FT E(): 7.8e-10, 37.931% id in 116 aa, and to Bacillus FT subtilis hypothetical proteinn YabA SW:YABA_BACSU (P37542) FT (119 aa) fasta scores: E(): 2.9e-09, 39.496% id in 119 aa" FT /product="conserved hypothetical protein" FT CDS 526318..527043 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0488" FT /note="Similar to Bacillus subtilis hypothetical protein FT YabB SW:YABB_BACSU (P37543) (247 aa) fasta scores: E(): FT 2.1e-42, 46.281% id in 242 aa, and to Streptococcus FT pyogenes hypothetical protein SPY1411 TR:Q99Z41 FT (EMBL:AE006578) (258 aa) fasta scores: E(): 4.2e-37, FT 41.803% id in 244 aa" FT /product="conserved hypothetical protein" FT CDS 527036..527284 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0489" FT /note="Similar to Halobacterium sp hypothetical protein FT VNG2274C TR:Q9HN31 (EMBL:AE005112) (77 aa) fasta scores: FT E(): 1.5e-13, 54.167% id in 72 aa, and to Bacillus FT subtilis hypothetical protein YazA TR:O31414 (EMBL:Z99104) FT (99 aa) fasta scores: E(): 4.3e-15, 53.086% id in 81 aa" FT /product="conserved hypothetical protein" FT CDS 527286..528125 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0490" FT /note="Similar to Bacillus halodurans BH0049 TR:Q9KGL2 FT (EMBL:AP001507) (289 aa) fasta scores: E(): 2.1e-45, FT 49.638% id in 276 aa, and to Bacillus subtilis FT hypothetical protein YabC SW:YABC_BACSU (P37544) (292 aa) FT fasta scores: E(): 3.3e-43, 46.595% id in 279 aa" FT /product="tetrapyrrole (corrin/porphyrin) methylase family FT protein" FT misc_feature 527292..527894 FT /note="Pfam match to entry PF00590 TP_methylase, FT Tetrapyrrole (Corrin/Porphyrin) Methylases., score 147.30, FT E-value 2.6e-40" FT /colour=9 FT misc_feature 527526..527561 FT /colour=8 FT /note="PS01296 Uncharacterized protein family UPF0011 FT signature." FT CDS 528410..530383 FT /EC_number="6.1.1.10" FT /class="2.2.01" FT /colour=2 FT /locus_tag="SAR0491" FT /gene="metG" FT /gene="metS" FT /note="Similar to Bacillus stearothermophilus FT methionyl-tRNA synthetase MetG SW:SYM_BACST (P23920) (649 FT aa) fasta scores: E(): 2.1e-121, 61.818% id in 660 aa, and FT to Bacillus subtilis methionyl-tRNA synthetase MetG FT SW:SYM_BACSU (P37465) (664 aa) fasta scores: E(): FT 1.7e-169, 65.303% id in 660 aa" FT /product="putative methionyl-tRNA synthetase" FT misc_feature 528413..529648 FT /note="Pfam match to entry PF00133 tRNA-synt_1, tRNA FT synthetases class I (I, L, M and V), score -104.80, FT E-value 3.7e-11" FT /colour=9 FT misc_feature 528452..528481 FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT signature." FT misc_feature 528851..528874 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 530096..530374 FT /note="Pfam match to entry PF01588 tRNA_bind, Putative FT tRNA binding domain, score 117.70, E-value 2.2e-31" FT /colour=9 FT CDS 530414..531187 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0492" FT /note="Similar to Bacillus subtilis putative FT deoxyribonuclease YabD SW:YABD_BACSU (P37545) (255 aa) FT fasta scores: E(): 1.4e-65, 65.625% id in 256 aa, and to FT Vibrio cholerae hypothetical protein VC2014 TR:Q9KQI4 FT (EMBL:AE004276) (255 aa) fasta scores: E(): 4.8e-36, FT 42.802% id in 257 aa" FT /product="putative TatD related DNase" FT misc_feature 530417..530443 FT /colour=8 FT /note="PS01137 Uncharacterized protein family UPF0006 FT signature 1." FT misc_feature 530432..531175 FT /note="Pfam match to entry PF01026 TatD_DNase, TatD FT related DNase, score 370.10, E-value 2.3e-107" FT /colour=9 FT misc_feature 530981..531031 FT /colour=8 FT /note="PS01091 Uncharacterized protein family UPF0006 FT signature 3." FT CDS 531354..531890 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0493" FT /note="Similar to Bacillus subtilis hypothetical protein FT YabF SW:YABF_BACSU (P37547) (186 aa) fasta scores: E(): FT 2.8e-27, 52.809% id in 178 aa, and to Streptococcus FT pyogenes hypothetical protein SPY0261 TR:Q9A1I1 FT (EMBL:AE006492) (189 aa) fasta scores: E(): 1.5e-26, FT 48.619% id in 181 aa" FT /product="conserved hypothetical protein" FT misc_feature 531363..531596 FT /note="Pfam match to entry PF01751 Toprim, Toprim domain, FT score 30.40, E-value 4.2e-05" FT /colour=9 FT CDS 531901..532794 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0494" FT /note="Similar to Bacillus subtilis putative FT dimethyladenosine transferase KsgA SW:KSGA_BACSU (P37468) FT (292 aa) fasta scores: E(): 1.7e-66, 61.702% id in 282 aa, FT and to Bacillus halodurans putative dimethyladenosine FT transferase KsgA TR:Q9KGK4 (EMBL:AP001507) (289 aa) fasta FT scores: E(): 1.1e-60, 57.491% id in 287 aa" FT /product="ribosomal RNA adenine dimethylase" FT misc_feature 531988..532761 FT /note="Pfam match to entry PF00398 RrnaAD, Ribosomal RNA FT adenine dimethylases, score 283.90, E-value 1.4e-87" FT /colour=9 FT misc_feature 532060..532143 FT /colour=8 FT /note="PS01131 Ribosomal RNA adenine dimethylases FT signature." FT CDS 532894..533157 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0495" FT /gene="veg" FT /note="Similar to Bacillus subtilis hypothetical protein FT Veg SW:VEG_BACSU (P37466) (86 aa) fasta scores: E(): FT 2.3e-18, 62.025% id in 79 aa, and to Bacillus halodurans FT hypothetical protein BH0059 TR:Q9KGK2 (EMBL:AP001507) (88 FT aa) fasta scores: E(): 1.4e-17, 58.750% id in 80 aa" FT /product="conserved hypothetical protein" FT CDS 533468..534316 FT /class="7.0.0" FT /colour=10 FT /locus_tag="SAR0496" FT /note="Similar to internal region of Mentha piperita FT (Peppermint) chloroplast FT 4-diphosphocytidyl-2-c-methyl-D-erythritol kinase IPK FT SW:ISPE_MENPI (P56848) (405 aa) fasta scores: E(): FT 4.8e-19, 30.153% id in 262 aa. Full length CDS is similar FT to Bacillus subtilis putative FT 4-diphosphocytidyl-2-c-methyl-D-erythritol kinase Ipk FT SW:ISPE_BACSU (P37550) (289 aa) fasta scores: E(): FT 3.1e-56, 50.534% id in 281 aa" FT /product="conserved hypothetical protein" FT CDS 534330..535154 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0497" FT /gene="purR" FT /note="Similar to Bacillus subtilis pur operon repressor FT PurR SW:PURR_BACSU (P37551) (285 aa) fasta scores: E(): FT 1.5e-54, 54.212% id in 273 aa, and to Bacillus halodurans FT purine operon repressor PurR TR:Q9KGJ9 (EMBL:AP001507) FT (282 aa) fasta scores: E(): 1.4e-49, 49.814% id in 269 aa" FT /product="putative pur operon repressor" FT misc_feature 534627..535097 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 87.70, E-value FT 2.3e-22" FT /colour=9 FT CDS 535171..535551 FT /class="6.1.1" FT /colour=9 FT /locus_tag="SAR0498" FT /gene="yabJ" FT /note="Similar to Bacillus subtilis putative regulator of FT purine biosynthesis YabJ SW:YABJ_BACSU (P37552) (124 aa) FT fasta scores: E(): 3.8e-25, 58.537% id in 123 aa, and to FT Bacillus halodurans translation initiation inhibitor FT BH0063 TR:Q9KGJ8 (EMBL:AP001507) (124 aa) fasta scores: FT E(): 2.1e-27, 62.097% id in 124 aa" FT /product="putative regulatory protein" FT misc_feature 535186..535539 FT /note="Pfam match to entry PF01042 UPF0076, YjgF family, FT score 210.80, E-value 2e-59" FT /colour=9 FT misc_feature 535465..535521 FT /colour=8 FT /note="PS01094 Uncharacterized protein family UPF0076 FT signature." FT CDS 535624..535926 FT /class="1.4.0" FT /colour=0 FT /locus_tag="SAR0499" FT /gene="spoVG" FT /note="Similar to Bacillus megaterium stage V sporulation FT protein G SpoVG SW:SP5G_BACME (P28016) (96 aa) fasta FT scores: E(): 1.4e-20, 70.930% id in 86 aa, and to Bacillus FT subtilis stage V sporulation protein G SpoVG SW:SP5G_BACSU FT (P28015) (97 aa) fasta scores: E(): 3.3e-20, 69.412% id in FT 85 aa" FT /product="stage V sporulation protein G" FT CDS 536269..537621 FT /EC_number="2.7.7.23" FT /class="4.1.9" FT /colour=3 FT /locus_tag="SAR0500" FT /gene="gcaD" FT /gene="tms" FT /gene="tms-26" FT /note="Similar to Bacillus subtilis FT UDP-N-acetylglucosamine pyrophosphorylase GcaD FT SW:GCAD_BACSU (P14192) (456 aa) fasta scores: E(): FT 3.5e-93, 55.234% id in 449 aa, and to Bacillus halodurans FT UDP-N-acetylglucosamine pyrophosphorylase GcaD TR:Q9KGJ6 FT (EMBL:AP001507) (455 aa) fasta scores: E(): 8.9e-95, FT 56.951% id in 446 aa" FT /product="putative UDP-N-acetylglucosamine FT pyrophosphorylase" FT misc_feature 536278..536955 FT /note="Pfam match to entry PF00483 NTP_transferase, FT Nucleotidyl transferase, score 34.50, E-value 3.1e-08" FT /colour=9 FT misc_feature 537061..537114 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 18.60, FT E-value 0.15" FT /colour=9 FT misc_feature 537115..537168 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 14.30, FT E-value 2.9" FT /colour=9 FT misc_feature 537214..537267 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 11.60, FT E-value 19" FT /colour=9 FT misc_feature 537268..537321 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 12.20, FT E-value 13" FT /colour=9 FT misc_feature 537370..537423 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 4.70, FT E-value 2e+02" FT /colour=9 FT misc_feature 537445..537498 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 3.80, FT E-value 2.5e+02" FT /colour=9 FT misc_feature 537472..537558 FT /colour=8 FT /note="PS00101 Hexapeptide-repeat containing-transferases FT signature." FT misc_feature 537499..537552 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 15.20, FT E-value 1.6" FT /colour=9 FT CDS 537768..538733 FT /EC_number="2.7.6.1" FT /class="3.3.17" FT /colour=7 FT /locus_tag="SAR0501" FT /gene="prs" FT /note="Similar to Bacillus subtilis ribose-phosphate FT pyrophosphokinase Prs SW:KPRS_BACSU (P14193) (317 aa) FT fasta scores: E(): 9.8e-93, 76.803% id in 319 aa, and to FT Corynebacterium ammoniagenes PRPP synthetase Prs TR:O33924 FT (EMBL:U76387) (317 aa) fasta scores: E(): 2.7e-92, 75.312% FT id in 320 aa" FT /product="ribose-phosphate pyrophosphokinase" FT misc_feature 538170..538217 FT /colour=8 FT /note="PS00114 Phosphoribosyl pyrophosphate synthetase FT signature." FT misc_feature 538191..538610 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 146.70, E-value FT 4e-40" FT /colour=9 FT misc_feature 538437..538475 FT /colour=8 FT /note="PS00103 Purine/pyrimidine phosphoribosyl FT transferases signature." FT CDS 538883..539536 FT /class="4.2.2" FT /colour=2 FT /locus_tag="SAR0502" FT /gene="rplY" FT /note="Similar to Thermotoga maritima probable 50S FT ribosomal protein L25 RplY or TM1627 SWALL:RL25_THEMA FT (SWALL:Q9X1W2) (215 aa) fasta scores: E(): 1.9e-14, 31.5% FT id in 219 aa, and to similar to Bacillus subtilis general FT stress protein Ctc SW:CTC_BACSU (P14194) (203 aa) fasta FT scores: E(): 3.7e-27, 45.685% id in 197 aa, and to FT Bacillus halodurans general stress protein Ctc TR:Q9KGJ4 FT (EMBL:AP001507) (215 aa) fasta scores: E(): 2.3e-24, FT 44.776% id in 201 aa. Probable RNA binding protein" FT /product="putative 50S ribosomal protein L25" FT misc_feature 538892..539155 FT /note="Pfam match to entry PF01386 Ribosomal_L25p, FT Ribosomal L25p family, score 108.10, E-value 1.7e-28" FT /colour=9 FT misc_feature 539300..539332 FT /colour=8 FT /note="PS00591 Glycosyl hydrolases family 10 active site." FT CDS 539847..540419 FT /EC_number="3.1.1.29" FT /class="2.2.01" FT /colour=2 FT /locus_tag="SAR0503" FT /note="Similar to Bacillus subtilis peptidyl-tRNA FT hydrolase Pth SW:PTH_BACSU (P37470) (188 aa) fasta scores: FT E(): 5e-35, 52.910% id in 189 aa, and to Bacillus FT halodurans peptidyl-tRNA hydrolase Pth SW:PTH_BACHD FT (Q9KGJ3) (185 aa) fasta scores: E(): 4.6e-32, 51.075% id FT in 186 aa" FT /product="putative peptidyl-tRNA hydrolase" FT misc_feature 539847..540404 FT /note="Pfam match to entry PF01195 Pept_tRNA_hydro, FT Peptidyl-tRNA hydrolase, score 279.60, E-value 4e-80" FT /colour=9 FT misc_feature 539886..539927 FT /colour=8 FT /note="PS01195 Peptidyl-tRNA hydrolase signature 1." FT misc_feature 540165..540197 FT /colour=8 FT /note="PS01196 Peptidyl-tRNA hydrolase signature 2." FT CDS 540419..543925 FT /class="2.2.03" FT /colour=2 FT /locus_tag="SAR0504" FT /note="Similar to Escherichia coli transcription-repair FT coupling factor Mfd SW:MFD_ECOLI (P30958) (1148 aa) fasta FT scores: E(): 2.1e-119, 37.169% id in 1095 aa, and to FT Bacillus subtilis transcription-repair coupling factor Mfd FT SW:MFD_BACSU (P37474) (1177 aa) fasta scores: E(): FT 1.2e-211, 49.490% id in 1176 aa" FT /product="putative transcription-repair coupling factor" FT misc_feature 542243..542854 FT /note="Pfam match to entry PF00270 DEAD, DEAD/DEAH box FT helicase, score 95.50, E-value 2.7e-29" FT /colour=9 FT misc_feature 542354..542377 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 542939..543193 FT /note="Pfam match to entry PF00271 helicase_C, Helicase FT conserved C-terminal domain, score 81.90, E-value 1.3e-20" FT /colour=9 FT CDS 543915..545441 FT /class="4.1.6" FT /colour=3 FT /locus_tag="SAR0505" FT /note="Similar to Bacillus subtilis stage V sporulation FT protein B SpoVB SW:SP5B_BACSU (Q00758) (518 aa) fasta FT scores: E(): 4.8e-14, 23.819% id in 529 aa, and to FT Bacillus halodurans hypothetical protein BH0071 TR:Q9KGJ0 FT (EMBL:AP001507) (533 aa) fasta scores: E(): 3.2e-33, FT 30.906% id in 508 aa" FT /product="putative polysaccharide biosynthesis protein" FT misc_feature 543930..544793 FT /note="Pfam match to entry PF01943 Polysacc_synt, FT Polysaccharide biosynthesis protein, score 62.50, E-value FT 8.9e-15" FT /colour=9 FT misc_feature join(543933..544001,544029..544097,544158..544226,544254..544322,544383..544436,544449..544508,544569..544628,544716..544784,544845..544904,544932..544985,545022..545090,545103..545171,545208..545276,545289..545357) FT /colour=0 FT /note="14 probable transmembrane helices predicted for FT SAR0505 by TMHMM2.0 at aa 7-29, 39-61, 82-104, 114-136, FT 157-174, 179-198, 219-238, 268-290, 311-330, 340-357, FT 370-392, 397-419, 432-454 and 459-481" FT CDS 545441..546634 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0506" FT /note="N-terminus is similar to N-terminal regions of FT Bacillus halodurans hypothetical protein BH0072 TR:Q9KGI9 FT (EMBL:AP001507) (491 aa) fasta scores: E(): 3.8e-63, FT 49.435% id in 354 aa, and Bacillus subtilis hypothetical FT protein YabN SW:YABN_BACSU (P37556) (489 aa) fasta scores: FT E(): 2e-62, 50.282% id in 354 aa" FT /product="putative tetrapyrrole (corrin/porphyrin) FT methylases" FT misc_feature 545450..546064 FT /note="Pfam match to entry PF00590 TP_methylase, FT Tetrapyrrole (Corrin/Porphyrin) Methylases., score 10.40, FT E-value 1.8e-06" FT /colour=9 FT CDS 546631..546894 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0507" FT /note="Similar to Bacillus subtilis hypothetical protein FT YabO SW:YABO_BACSU (P37557) (86 aa) fasta scores: E(): FT 1.8e-18, 68.605% id in 86 aa, and to Bacillus halodurans FT hypothetical protein BH0073 TR:Q9KGI8 (EMBL:AP001507) (88 FT aa) fasta scores: E(): 5.9e-17, 67.901% id in 81 aa" FT /product="S4 domain containing protein" FT misc_feature 546631..546771 FT /note="Pfam match to entry PF01479 S4, S4 domain, score FT 34.30, E-value 2.7e-06" FT /colour=9 FT CDS 546912..547304 FT /class="1.7.1" FT /colour=3 FT /locus_tag="SAR0508" FT /note="Similar to Bacillus subtilis cell division protein FT DivIC SW:DIVC_BACSU (P37471) (125 aa) fasta scores: E(): FT 5.8e-06, 32.743% id in 113 aa, and to Listeria FT monocytogenes DivIC homolog DivL TR:Q9ZIM0 (EMBL:AF023181) FT (128 aa) fasta scores: E(): 2.5e-07, 37.097% id in 124 aa" FT /product="putative cell division protein" FT misc_feature 546912..547079 FT /note="Signal peptide predicted for SAR0508 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.991) with cleavage site FT probability 0.494 between residues 56 and 57" FT /colour=6 FT misc_feature 547011..547070 FT /colour=0 FT /note="1 probable transmembrane helix predicted for FT SAR0508 by TMHMM2.0 at aa 34-53" FT CDS 547409..547810 FT /class="7.0.0" FT /colour=13 FT /locus_tag="SAR0509" FT /note="Similar to Bacillus subtilis hypothetical protein FT YabR SW:YABR_BACSU (P37560) (128 aa) fasta scores: E(): FT 3.4e-26, 63.433% id in 134 aa. N-terminal region is FT similar to the C-terminus of Escherichia coli FT polyribonucleotide nucleotidyltransferase Pnp SW:PNP_ECOLI FT (P05055) (711 aa) fasta scores: E(): 8.1e-08, 48.485% id FT in 99 aa" FT /product="putative RNA binding protein" FT misc_feature 547412..547630 FT /note="Pfam match to entry PF00575 S1, S1 RNA binding FT domain, score 89.30, E-value 4.5e-23" FT /colour=9 FT CDS 547990..549285 FT /class="0.0.2" FT /colour=10 FT /locus_tag="SAR0510" FT /note="Similar to Bacillus subtilis hypothetical protein FT YacA SW:YACA_BACSU (P37563) (472 aa) fasta scores: E(): FT 1e-15, 27.740% id in 447 aa, and to Buchnera aphidicola FT (subsp. Acyrthosiphon pisum) putative cell cycle protein FT BU110 SW:MESJ_BUCAI (P57211) (440 aa) fasta scores: E(): FT 2.5e-16, 25.120% id in 418 aa" FT /product="conserved hypothetical protein" FT CDS 549290..549829 FT /EC_number="2.4.2.8" FT /class="3.3.17" FT /colour=7 FT /locus_tag="SAR0511" FT /gene="hpt" FT /note="Similar to Vibrio harveyi hypoxanthine FT phosphoribosyltransferase Hpt SW:HPRT_VIBHA (P18134) (176 FT aa) fasta scores: E(): 4e-28, 50.000% id in 170 aa, and to FT Bacillus subtilis hypoxanthine-guanine FT phosphoribosyltransferase HprT SW:HPRT_BACSU (P37472) (180 FT aa) fasta scores: E(): 1.6e-37, 60.452% id in 177 aa" FT /product="putative hypoxanthine phosphoribosyltransferase" FT misc_feature 549290..549751 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 103.10, E-value FT 5.3e-27" FT /colour=9 FT CDS 550087..552180 FT /EC_number="3.4.24.-" FT /class="1.7.1" FT /colour=3 FT /locus_tag="SAR0512" FT /gene="ftsH" FT /note="Similar to Bacillus firmus cell division protein FT FtsH homologue FtsH SW:FTSH_BACFI (P94304) (679 aa) fasta FT scores: E(): 8.4e-133, 61.437% id in 682 aa, and to FT Bacillus subtilis cell division protein FtsH homologue FT FtsH SW:FTSH_BACSU (P37476) (637 aa) fasta scores: E(): FT 4.1e-135, 66.984% id in 630 aa" FT /product="putative cell division protein" FT misc_feature 550087..550161 FT /note="Signal peptide predicted for SAR0512 by SignalP 2.0 FT HMM (Signal peptide probabilty 0.753) with cleavage site FT probability 0.375 between residues 25 and 26" FT /colour=6 FT misc_feature join(550096..550164,550414..550482) FT /colour=0 FT /note="2 probable transmembrane helices predicted for FT SAR0512 by TMHMM2.0 at aa 4-26 and 110-132" FT misc_feature 550684..551247 FT /note="Pfam match to entry PF00004 AAA, ATPase family FT associated with various cellular activities (AAA), score FT 338.90, E-value 5.6e-98" FT /colour=9 FT misc_feature 550699..550722 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 550996..551052 FT /colour=8 FT /note="PS00674 AAA-protein family signature." FT misc_feature 551263..551895 FT /note="Pfam match to entry PF01434 Peptidase_M41, FT Peptidase family M41, score 427.40, E-value 1.3e-124" FT /colour=9 FT CDS 552594..553475 FT /class="1.3.1" FT /colour=0 FT /locus_tag="SAR0513" FT /note="Similar to Escherichia coli 33 kDa chaperonin (heat FT shock protein 33) HslO SW:HSLO_ECOLI (P45803) (292 aa) FT fasta scores: E(): 5.3e-06, 25.524% id in 286 aa, and to FT Bacillus subtilis 33 kDa chaperonin HslO SW:HSLO_BACSU FT (P37565) (291 aa) fasta scores: E(): 1.3e-72, 68.772% id FT in 285 aa" FT /product="putative chaperonin" FT misc_feature 552603..553457 FT /note="Pfam match to entry PF01430 HSP33, Hsp33 protein, FT score 495.60, E-value 3.8e-145" FT /colour=9 FT CDS 553654..554586 FT /class="3.1.06" FT /colour=7 FT /locus_tag="SAR0514" FT /note="Similar to Methanosarcina barkeri O-acetylserine FT CysK TR:Q9UWP0 (EMBL:AF174138) (308 aa) fasta scores: E(): FT 2.4e-61, 60.927% id in 302 aa, and to Bacillus subtilis FT cysteine synthase CysK SW:CYSK_BACSU (P37887) (307 aa) FT fasta scores: E(): 1.1e-76, 69.307% id in 303 aa" FT /product="putative O-acetylserine (thiol)-lyase" FT misc_feature 553678..554541 FT /note="Pfam match to entry PF00291 PALP, FT Pyridoxal-phosphate dependent enzyme, score 434.10, FT E-value 1.3e-126" FT /colour=9 FT misc_feature 553756..553812 FT /colour=8 FT /note="PS00901 Cysteine synthase/cystathionine FT beta-synthase P-phosphate attachment site." FT CDS 554802..555605 FT /EC_number="2.5.1.15" FT /class="3.2.05" FT /colour=7 FT /locus_tag="SAR0515" FT /gene="folP" FT /note="Previously sequenced as Staphylococcus aureus FT dihydropteroate synthase FolP SW:DHPS_STAAU (O05701) (267 FT aa) fasta scores: E(): 9.5e-100, 100.000% id in 267 aa. FT Similar to Staphylococcus haemolyticus dihydropteroate FT synthase FolP SW:DHPS_STAHA (Q59919) (267 aa) fasta FT scores: E(): 3.5e-76, 74.157% id in 267 aa" FT /product="dihydropteroate synthase" FT misc_feature 554817..554864 FT /colour=8 FT /note="PS00792 Dihydropteroate synthase signature 1." FT misc_feature 554820..555566 FT /note="Pfam match to entry PF00809 DHPS, Dihydropteroate FT synthase, score 512.70, E-value 2.7e-150" FT /colour=9 FT misc_feature 554919..554960 FT /colour=8 FT /note="PS00793 Dihydropteroate synthase signature 2." FT CDS 555583..555948 FT /EC_number="4.1.2.25" FT /class="3.2.05" FT /colour=7 FT /locus_tag="SAR0516" FT /gene="folB" FT /note="Previously sequenced as Staphylococcus aureus FT dihydroneopterin aldolase FolB SW:FOLB_STAAU (P56740) (121 FT aa) fasta scores: E(): 7.2e-44, 100.000% id in 121 aa. FT Similar to Bacillus subtilis dihydroneopterin aldolase FT FolB SW:FOLB_BACSU (P28823) (120 aa) fasta scores: E(): FT 1.8e-19, 47.863% id in 117 aa" FT /product="dihydroneopterin aldolase" FT misc_feature 555595..555936 FT /note="Pfam match to entry PF02152 FolB, Dihydroneopterin FT aldolase, score 143.70, E-value 2.1e-40" FT /colour=9 FT CDS 555945..556421 FT /EC_number="2.7.6.3" FT /class="3.2.05" FT /colour=7 FT /locus_tag="SAR0517" FT /gene="folK" FT /note="Similar to Escherichia coli FT 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine FT pyrophosphokinase FolK SW:HPPK_ECOLI (P26281) (158 aa) FT fasta scores: E(): 2e-18, 41.429% id in 140 aa, and to FT Bacillus subtilis FT 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine FT pyrophosphokinase FolK SW:HPPK_BACSU (P29252) (167 aa) FT fasta scores: E(): 9.9e-25, 53.030% id in 132 aa" FT /product="putative FT 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine FT pyrophosphokinase" FT misc_feature 555951..556340 FT /note="Pfam match to entry PF01288 HPPK, FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT (HPPK), score 202.60, E-value 7e-58" FT /colour=9 FT misc_feature 556206..556241 FT /colour=8 FT /note="PS00794 FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT signature." FT CDS 556960..558447 FT /EC_number=