Probably the best way to use genefinder is to utilise the version that is present within ACEDB. This will involve converting your sequence into an 'acefile'format. The acefile format required to create a new sequence object is quite simple and is shown below.
Sequence "test" DNA "test" GATCCTTACTTCAACGTTAACAGTTCGCATCTCGGCCATCTTAAATGTTATAGAAAAAGT GTCAACAGCAAAAATGTTCAAAATATTTTTCCTATAATTTTGTAGTTGACAACCTTTTGA TATTATCACAAATTACTGAGATAAATGCTTCGAAAGTTGTGTAGAAATGAAGAACAGGCG TGGTGTAATTGCAATTCAAAAAAAACGTTTTGTATCCAAATTTCGAAGTAATTACATACA TGAATATTTAAAGTGTTGAATGTCGACCTACCTGACTTCAAATCTTCTTTTAAAGAATGA TAGAGAGGGAGAGAAACAGAGAAAAATACAGAAAACTTGTTGAAACTGAAGATTGTTTCC AAATAGTCTGTCTTCAGCAAAAAAAAGTAGTGACAATCTCGGGATTATTCTTAGTATTTC TTAAGACGAGGTAAAAGTTTTCTTTCTCTCTCCTCTTTTCTGAATCCTTTTTCAAAACGA AGAGAGTACGTAGTTCAAGGAGACACAGACAGTGTCACTCCAGAAACTGTAGAAGAAGTG(where "test" is the name of your sequence).
This file should then be given an .ace suffix and then can be read in to acedb. To read the sequence into ACEDB select write access from the main ACEDB menu and then select 'read .ace file' which will then ask you to open a file and allow you to read it in. This should now give a sequence object which you can now click on.
Once you have the sequence object you can start your analysis. Use the genefinder menu and select genefinder features which will show you the splices, orfs etc for that strand.
Then you can select autofind_one_gene which will run genefinder and find the highest scoring gene. Because of this you may wish to select the precise region of study. Do this by entering the coordinates in the active zone box (yellow).Once genefinder finds a gene the features will be in green and subsequent autofind gene commands will try and incorporate any green (selected) features. Therefore it is important to remember that clicking on clear will remove all the green (selected) features.
If you want genefinder to incorporate a particular splice site or start codon etc. you can 'select' this (right mouse button, over the feature will call up the menu) before running autofind_one_gene. Likewise if you do not want a feature to be used instead of selecting this feature use anti-select which will mark this feature to be ignored by genefinder.
Once genefinder has given the initial prediction you may wish to change this. You can easily do this changing the selected features (i.e. those in green). Thus one can change splice sites selected by unselecting one and selecting another. Once the changes have been made using 'Selected to temp gene' will create your new gene. Bear in mind that selecting a splice site of a different colour will change the frame and so compensating changes elsewhere in the gene prediction will have to be made. Also be aware that genefinder will not warn you if subsequent changes to the gene cause stops to be incorporated, so a visual inspection is needed every time the gene prediction is changed manually. To view the translation of the predicted gene use the right mouse button over the predicted gene structure and select 'show translation'. This menu will also allow you to export the protein and cDNA sequences of the predicted genes.
You can also make your own genes by selecting ALL the features yourself and using the 'selected to temp gene' command in the genefinder menu. Rememeber that you have to select a start, all the relevant and splices and a stop - the stop is selected by selecting the last orf. Also remember to use the clear button before you attempt this so that genefinder does not attempt to include selected features from previous gene predictions. Not using 'clear' is probably the most common cause for genefinder not doing what you want it to.
If you have a gene and you wish to see the genefinder features used select the gene by clicking on it and then selecting 'gene to selected' the features will show up in green and of course can now be edited as before.
To investigate the other DNA strand simply click on the 'rev-comp' button.
Once you have the gene structure you want you can 'fix' it. Therefore, just click on the gene you wish to 'fix' and select 'fix temp gene' for the genefinder menu, which will then allow you to give the gene the name of your choice.
