zgc:77778

Ensembl ID:
ENSDARG00000095751
ZFIN ID:
ZDB-GENE-040426-2281
Description:
UPF0762 protein C6orf58 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q4QRF7]
Human Orthologue:
C6orf58
Human Description:
chromosome 6 open reading frame 58 [Source:HGNC Symbol;Acc:20960]
Mouse Orthologue:
2310057J18Rik
Mouse Description:
RIKEN cDNA 2310057J18 gene Gene [Source:MGI Symbol;Acc:MGI:1914969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1814 Missense F2 line generated During 2018
sa6612 Nonsense Mutation detected in F1 DNA During 2018
sa10898 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1814
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002242 Missense 67 364 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 1422243)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1378108
GRCz11 20 1398934
KASP Assay ID:
554-1806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGGTAAACCCGTGGGTCTACTCCCAGAGGATGACCATGTTGAAAAT[G/T]GTGATCAACGCTACTAATGCCTACATGAGCTCCATGGGCCCCGGGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002242 Nonsense 178 364 3 6
Genomic Location (Zv9):
Chromosome 20 (position 1425366)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1381231
GRCz11 20 1402057
KASP Assay ID:
554-4842.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTCCCAGCAGAAGTGGCTCAGGATTACTGCTCCAGCTACAGMGACTG[C/A]TMCACCAAACACCCCRACRCCATKGCCAAATGGCACCTCTYTTTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002242 Nonsense 226 364 4 6
Genomic Location (Zv9):
Chromosome 20 (position 1427425)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1383290
GRCz11 20 1404116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGACAGCATTCTGGGYCTRATGTGGGCTGCCGAGGAGGAGTCTMTA[C/T]AAACCGCCTCTGGGGCTTGCACTGAAAGGTCAGCATACATTACATTCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link