si:dkeyp-50f5.4

Ensembl ID:
ENSDARG00000095726
ZFIN ID:
ZDB-GENE-070705-545
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S7D0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15220 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa15220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139148 Missense 46 93 4 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 49138937)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48914345
GRCz11 20 48745562
KASP Assay ID:
2261-4946.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGATTGGCWTCTTTGGATGASAGGAATGTCCATTCTTCTCCTYCTC[T/A]GCCCTCCTCTTTCACCACCCGCTMTATGGCTCGCCCCACCAGCCCACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link