si:dkey-4c15.13

Ensembl ID:
ENSDARG00000095704
ZFIN ID:
ZDB-GENE-030131-2023
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZB4]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29690 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12355 Nonsense Available for shipment Available now
sa29691 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132149 Essential Splice Site None 141 None 3
ENSDART00000139844 Essential Splice Site None 121 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 1611575)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2352665
GRCz11 22 2368931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTCAGCGCTGACGCGTTCATTCAGCGTCGAGTCTTCAGAGCTGAGG[T/G]GAGTCGTTGACGCTTTTTCTCGTGTTTACACGACAATAAAACACACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132149 Nonsense 118 141 3 3
ENSDART00000139844   None 121 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1616747)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2357837
GRCz11 22 2374103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAAACCTGACAAAGCACGAGAGGACTCACACYGGAGAGAAACCGTA[T/A]CACTGCACTGCTTGTGGGAAGAATTTCTCACAGTCATCCTCTCTACGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132149 Nonsense 134 141 3 3
ENSDART00000139844   None 121 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1616793)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2357883
GRCz11 22 2374149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATCACTGCACTGCTTGTGGGAAGAATTTCTCACAGTCATCCTCTCTA[C/T]GAACACACAGAAAAACCATTCACAGTAAGTAGATCTACGCAACCCAACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link