si:dkey-240n22.1

Ensembl ID:
ENSDARG00000095696
ZFIN ID:
ZDB-GENE-070705-407
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S5A0]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44596 Nonsense Mutation detected in F1 DNA During 2018
sa40340 Nonsense Mutation detected in F1 DNA During 2018
sa38445 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855 Nonsense 26 107 3 5
ENSDART00000134357   None 975 None 7
ENSDART00000135345 Nonsense 26 527 3 7
Genomic Location (Zv9):
Chromosome 4 (position 60965162)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75445961
GRCz11 4 77022699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTCTCTTCAGTGTGAGATCAGGATCATGTGTGAAGAGTGACTG[G/A]TCTAAAGAGGATCCACCAGAGTTCAGTGAGGAAACACCATCACCTGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855   None 107 None 5
ENSDART00000134357 Nonsense 89 975 2 7
ENSDART00000135345 Nonsense 250 527 7 7
Genomic Location (Zv9):
Chromosome 4 (position 60971415)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75452214
GRCz11 4 77028952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCTAGATGTCATCAGTCACTAGAGATGAAGATTGAATGTAAACATT[T/A]GTTTGAAGCAGCTGAACAAGACAAGCAGATCAGAACTGTCCTGACAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855   None 107 None 5
ENSDART00000134357 Essential Splice Site 727 975 5 7
ENSDART00000135345   None 527 None 7
Genomic Location (Zv9):
Chromosome 4 (position 60980841)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75461640
GRCz11 4 77038378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGTGTGATTGTCCAACAGTGTGATGTGGACTGTTTGTGTGTTTGTA[G/A]ATTGTCTGGCTGTATGGTGACAGAGGAAGGCTGTGGTTTGCTGTCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link