si:dkeyp-67d2.5

Ensembl ID:
ENSDARG00000095675
ZFIN ID:
ZDB-GENE-081104-472
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S755]
Human Orthologue:
CCDC141
Human Description:
coiled-coil domain containing 141 [Source:HGNC Symbol;Acc:26821]
Mouse Orthologue:
Ccdc141
Mouse Description:
coiled-coil domain containing 141 Gene [Source:MGI Symbol;Acc:MGI:1919735]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11814 Nonsense Available for shipment Available now
sa18522 Nonsense Available for shipment Available now
sa15829 Essential Splice Site Available for shipment Available now
sa41541 Nonsense Mutation detected in F1 DNA During 2018
sa34749 Nonsense Available for shipment Available now
sa947 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa11814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Nonsense 359 1696 7 26
ENSDART00000134349   None 605 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44191292)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43316462
GRCz11 9 43118249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCATGATGAGTAGACAGGCTCATCTGCAAGAGAGCAATRCTTTTTA[C/A]AGCAGCGCTAATAAAGTACGTAATCAAGYAGCACTTCACATACTTTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Nonsense 506 1696 10 26
ENSDART00000134349   None 605 None 9
Genomic Location (Zv9):
Chromosome 9 (position 44187314)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43312484
GRCz11 9 43114271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTAACTGAGGCTGAAGACGCTCTGAACAAGCATGTTGAGCTGCTMT[C/A]ACAGTCTCAGGTGAATTCCTGCCCCTAGATRAGATTATAGTATGATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Essential Splice Site 798 1696 15 26
ENSDART00000134349   None 605 None 9
Genomic Location (Zv9):
Chromosome 9 (position 44183374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43308544
GRCz11 9 43110331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAACTGTTCTCAGCATGGCCAGCAARTTTCATCAGCTTTATCAAGAGG[T/G]AAAGGCTCATTTCTGTCCAAMACTTTAGAGAATCAGTGTAAGCTTAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Nonsense 998 1696 19 26
ENSDART00000134349 Nonsense 182 605 4 9
Genomic Location (Zv9):
Chromosome 9 (position 44164951)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43290121
GRCz11 9 43091908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTAAATGAGCTGCAGAGACAGGTGGGCGACTTTGACAGGGCAGTGGAG[G/T]AGTACAAACAAAACCTGGACATGAATGTCAAGCTCCAGCAGGCTTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Nonsense 1304 1696 23 26
ENSDART00000134349 Nonsense 488 605 8 9
Genomic Location (Zv9):
Chromosome 9 (position 44161789)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43286959
GRCz11 9 43088746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGAAAAACCTTGCCCTGTTCAGAAGACCAGCTCTGAGGACAAGTAT[C/T]AGGCCTGTAATAGAAATCCCCCTTTACATTCATATTCCAAGGTGAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa947
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109613 Nonsense 1662 1696 26 26
ENSDART00000134349   None 605 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44149787)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43274957
GRCz11 9 43076744
KASP Assay ID:
554-0852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTAAACTGATTTCCTCAGGTTGTAGGAACASTCCACACTTCCTCTCC[A/T]GAGTGGATGGGCAAAATGTACTGGTGGAAGAAGACCTCAGCTCACACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link