si:dkey-261j4.5

Ensembl ID:
ENSDARG00000095635
ZFIN ID:
ZDB-GENE-060531-126
Description:
Novel protein similar to draculin (Drl) [Source:UniProtKB/TrEMBL;Acc:B0R156]
Human Orthologues:
BX248098.1, ZNF107, ZNF160, ZNF197, ZNF208, ZNF616, ZNF658, ZNF721, ZNF729, ZNF808, ZNF836, ZNF841, ZNF845, ZNF91, ZNF99
Human Descriptions:
zinc finger protein 107 [Source:HGNC Symbol;Acc:12887]
zinc finger protein 160 [Source:HGNC Symbol;Acc:12948]
zinc finger protein 197 [Source:HGNC Symbol;Acc:12988]
zinc finger protein 208 [Source:HGNC Symbol;Acc:12999]
zinc finger protein 616 [Source:HGNC Symbol;Acc:28062]
zinc finger protein 658 [Source:HGNC Symbol;Acc:25226]
Zinc finger protein 658B [Source:UniProtKB/Swiss-Prot;Acc:Q4V348]
zinc finger protein 721 [Source:HGNC Symbol;Acc:29425]
zinc finger protein 729 [Source:HGNC Symbol;Acc:32464]
zinc finger protein 808 [Source:HGNC Symbol;Acc:33230]
zinc finger protein 836 [Source:HGNC Symbol;Acc:34333]
zinc finger protein 841 [Source:HGNC Symbol;Acc:27611]
zinc finger protein 845 [Source:HGNC Symbol;Acc:25112]
zinc finger protein 91 [Source:HGNC Symbol;Acc:13166]
zinc finger protein 99 [Source:HGNC Symbol;Acc:13175]
Mouse Orthologues:
A530054K11Rik, AA987161, Zfp748
Mouse Descriptions:
expressed sequence AA987161 Gene [Source:MGI Symbol;Acc:MGI:2145180]
RIKEN cDNA A530054K11 gene Gene [Source:MGI Symbol;Acc:MGI:3036250]
zinc finger protein 748 Gene [Source:MGI Symbol;Acc:MGI:1916455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20563 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097363 Nonsense 5 981 1 4
ENSDART00000133426   None 631 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 64679574)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60932234
GRCz11 5 61616955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACATGACACTCCACCCTAAATACAAGCCGTACAAATGTGATCAATGC[G/T]AGAAGAGTTACGGGCGAGAAGACCACCTTCAGAGACACATGAAGCTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link