
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000095517
- Ensembl ID:
- ENSDARG00000095517
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5267 | Nonsense | F2 line generated | During 2018 |
sa7322 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5267
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000148283 | Nonsense | 371 | 376 | 1 | 1 |
ENSDART00000148283 | Nonsense | 371 | 376 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 4 (position 38257897)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 30113276 GRCz11 4 30067800 - KASP Assay ID:
- 554-3583.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCAGCCAATCATCAAACCTTAATAAACACATGGTGAGCCACACCATT[C/T]AGAGTAATCATTCACTTGCACTTTAGCCACGRTAACACTGGACTTCTCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7322
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000148283 | Nonsense | 371 | 376 | 1 | 1 |
ENSDART00000148283 | Nonsense | 371 | 376 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 4 (position 38257897)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 30113276 GRCz11 4 30067800 - KASP Assay ID:
- 554-3583.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCAGCCAATCATCAAACCTTAATAAACACATGGTGAGCCACACCATT[C/T]AGAGTAATCATTCACTTGCACTTTAGCCACGRTAACACTGGACTTCTCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: