si:dkey-78l4.4

Ensembl ID:
ENSDARG00000095438
ZFIN ID:
ZDB-GENE-060503-836
Description:
Novel protein containing a trypsin domain [Source:UniProtKB/TrEMBL;Acc:Q1LUL6]
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144494 Nonsense 72 254 2 5
Genomic Location (Zv9):
Chromosome 22 (position 19735116)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19391809
GRCz11 22 19416787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGATTCCTCATTACTGAACAGTTTGTCTTGACTGCTGCACATTGCTG[G/A]AATGAGTAAGCATTTTRTTTARTGTGTATTRCAATGTTGAGTTTAAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link