
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch1073-75f15.2
- Ensembl ID:
- ENSDARG00000095394
- ZFIN ID:
- ZDB-GENE-081031-89
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLP5]
- Human Orthologue:
- C15orf60
- Human Description:
- chromosome 15 open reading frame 60 [Source:HGNC Symbol;Acc:25065]
- Mouse Orthologue:
- 2410076I21Rik
- Mouse Description:
- RIKEN cDNA 2410076I21 gene Gene [Source:MGI Symbol;Acc:MGI:1920923]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23201 | Missense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23201
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000135090 | Missense | 69 | 140 | 2 | 4 |
The following transcripts of ENSDARG00000095394 do not overlap with this mutation:
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 956081)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 1264018 GRCz11 18 1156394 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAAATGGATCTATTTCTGTCTCTTCTTCAGGCCCCTGAAGATGCTCCAC[G/T]GGCAGCCCCTGCTGTTGCTGAGGGGCCGCTGTCAATCAAACACCTTTCCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: