wu:fb68b01

Ensembl ID:
ENSDARG00000095315
ZFIN ID:
ZDB-GENE-030131-1342
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22627 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142311 Nonsense 189 718 5 18
Genomic Location (Zv9):
Chromosome 15 (position 20054538)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21157164
GRCz11 15 21092896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTAATGCTGCAGGCTGAAGGAATCAAAAAGGCAAAGACCAACAGCTG[G/A]TTACTGTGTCCAAAGGGTTTGACTTCAGACAGTATTTAGTATCATAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link