
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fb68b01
- Ensembl ID:
- ENSDARG00000095315
- ZFIN ID:
- ZDB-GENE-030131-1342
- Human Orthologue:
- A2ML1
- Human Description:
- alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22627 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22627
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000142311 | Nonsense | 189 | 718 | 5 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 20054538)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 21157164 GRCz11 15 21092896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTAATGCTGCAGGCTGAAGGAATCAAAAAGGCAAAGACCAACAGCTG[G/A]TTACTGTGTCCAAAGGGTTTGACTTCAGACAGTATTTAGTATCATAGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: