
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NM_200623.1
- Ensembl ID:
- ENSDARG00000095305
- Description:
- WD repeat domain 46 (wdr46), mRNA [Source:RefSeq DNA;Acc:NM_200623]
- Human Orthologue:
- WDR46
- Human Description:
- WD repeat domain 46 [Source:HGNC Symbol;Acc:13923]
- Mouse Orthologue:
- Wdr46
- Mouse Description:
- WD repeat domain 46 Gene [Source:MGI Symbol;Acc:MGI:1931871]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa27295 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa27295
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000141889 | Essential Splice Site | 71 | 147 | None | 3 |
The following transcripts of ENSDARG00000095305 do not overlap with this mutation:
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 55409740)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 53216617 GRCz11 8 53095196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACCAGGCCAGCTTTGAGCAGAGACACAAGGAACGGGTTGAAGTAATGG[T/A]GAGTCGGCCTGACGCTATTAATGGTGATTTTTAATCAAACTGATGACTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: