zgc:152652

Ensembl ID:
ENSDARG00000095281
ZFIN ID:
ZDB-GENE-060818-27
Description:
hypothetical protein LOC751595 [Source:RefSeq peptide;Acc:NP_001038805]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1549 Nonsense F2 line generated During 2018
sa37830 Nonsense Mutation detected in F1 DNA During 2018
sa7524 Missense Mutation detected in F1 DNA During 2018
sa25209 Nonsense Mutation detected in F1 DNA During 2018
sa17115 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1549
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137794 Nonsense 64 807 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9790855)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9849739
GRCz11 24 9990125
KASP Assay ID:
554-1492.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCCATCTTGGATCTAATAATCCTAGCCAGTCCATGCAGGAGGTGAAA[C/T]AAAGTGTCCTTGACTTTTATGGTGGAAATGTTGTAGCTGGGCCAGTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137794 Nonsense 227 807 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9790365)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9849249
GRCz11 24 9989635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCAACCAGCAACTTCTGGAACCATAGCCCAGTCTAGCCCTCTGCTGT[T/A]GTCCCTGCCCAGTGGCCAACAGATATTTCAGACTAGCTTCCAGTCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137794 Missense 455 807 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9789682)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9848566
GRCz11 24 9988952
KASP Assay ID:
554-4286.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCAACAACCAGCACAAATAATCTACCAGTCTGCTAGCCAGCCCACK[G/A]TGCCACAATTAGTAGAAGCCATCTATGAATCAGAGACCCAGCCTGCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137794 Nonsense 510 807 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9789515)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9848399
GRCz11 24 9988785
KASP Assay ID:
554-7535.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCATCTGTATCCCAACCAAGCCATCTGCAAGCAGGACAGTCCAACTA[T/A]GAGTATGTTGTCAACCAAAATGGGCAAACCCTTTTCAAGCCAGTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137794 Nonsense 647 807 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9789106)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9847990
GRCz11 24 9988376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATACTTTAGTATCTCWGCCCACTGGTCATCCTTCAAGRCCATTGCAG[C/T]AGCCTAGCTACCAGCCTCCWGYMAAGCTATGGCAAAATTTGYTTTTGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link