
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-138e16.4
- Ensembl ID:
- ENSDARG00000095269
- ZFIN ID:
- ZDB-GENE-070705-203
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWL1]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43749 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12104 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43749
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000139258 | Nonsense | 139 | 233 | 3 | 3 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 2464872)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 1277720 GRCz11 22 1294618 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTCACACCTGCAGAACCATCTGAGAGTTCACACTAAAGAGAAACCGTA[T/A]TCATGCTGTGAGTGTGGGAAGAGCTTTGCAACGCAGTCCAGTTTACGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12104
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000139258 | Nonsense | 198 | 233 | 3 | 3 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 2465048)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 1277896 GRCz11 22 1294794 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGAAGAAGCACCAGAGGATTCACACTGAGGAGAAACCRTACAAGTGTT[C/A]ATACTGCGACAAGAGCTTCAGGCGGACAGGAGACCTGAAAGTGCATGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: