zgc:153720

Ensembl ID:
ENSDARG00000095234
ZFIN ID:
ZDB-GENE-060929-982
Description:
hypothetical protein LOC767719 [Source:RefSeq peptide;Acc:NP_001070125]
Human Orthologues:
VWDE, WIF1
Human Descriptions:
von Willebrand factor D and EGF domains [Source:HGNC Symbol;Acc:21897]
WNT inhibitory factor 1 [Source:HGNC Symbol;Acc:18081]
Mouse Orthologue:
Wif1
Mouse Description:
Wnt inhibitory factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344332]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7384 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084891 Missense 76 189 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39845341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38764740
GRCz11 1 39482813
KASP Assay ID:
554-4292.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGC[C/T]GCCARGKTGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link