si:ch73-243b8.4

Ensembl ID:
ENSDARG00000095174
ZFIN ID:
ZDB-GENE-091204-453
Human Orthologue:
HMHA1
Human Description:
histocompatibility (minor) HA-1 [Source:HGNC Symbol;Acc:17102]
Mouse Orthologue:
Hmha1
Mouse Description:
histocompatibility (minor) HA-1 Gene [Source:MGI Symbol;Acc:MGI:1917969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45767 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138483 Essential Splice Site 200 277 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17865688)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17616623
GRCz11 22 17641601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTGGAGACGCTCACCGCTGCTGGAAAACTCATCTCACAGGTCAAAGG[T/G]CAGAGCAAGGCACTTCTGGGTCTCGAAATTAAACACATTCTCAAACTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link