ZFP37 (2 of 45)

Ensembl ID:
ENSDARG00000095126
Description:
zinc finger protein 37 homolog (mouse) [Source:HGNC Symbol;Acc:12863]
Human Orthologue:
ZFP37
Human Description:
zinc finger protein 37 homolog (mouse) [Source:HGNC Symbol;Acc:12863]
Mouse Orthologue:
Zfp37
Mouse Description:
zinc finger protein 37 Gene [Source:MGI Symbol;Acc:MGI:99181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33505 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135452 Nonsense 122 362 2 4
Genomic Location (Zv9):
Chromosome 4 (position 56406979)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 59019163
GRCz11 4 60937086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGAAACCTTACACCTGCGAACAGTGTGGAAAGAGTTTTGGTCAAAAA[C/T]AAAGCTTTAAAACGCACATGAGAATTCACACTGGAGAGAGGCCGTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link