
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-240n22.3
- Ensembl ID:
- ENSDARG00000095013
- ZFIN ID:
- ZDB-GENE-070705-409
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5A2]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33513 | Nonsense | Available for shipment | Available now |
sa9668 | Nonsense | Available for shipment | Available now |
sa9578 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33513
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134509 | Nonsense | 589 | 794 | 2 | 7 |
ENSDART00000142978 | None | 320 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60921756)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 75402555 GRCz11 4 76979293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGAGCTGGAGGAGTTTGAGCTTCACAAATTCCAGAGATCAGACGAGTG[T/A]CTCATCAGACTATCAGCAGTCATCAAAACCTCCAAAAGAGCTCTGTAAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9668
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134509 | Nonsense | 782 | 794 | 7 | 7 |
ENSDART00000142978 | None | 320 | None | 6 | |
ENSDART00000134509 | Nonsense | 782 | 794 | 7 | 7 |
ENSDART00000142978 | None | 320 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60929724)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 75410523 GRCz11 4 76987261 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9578
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134509 | Nonsense | 782 | 794 | 7 | 7 |
ENSDART00000142978 | None | 320 | None | 6 | |
ENSDART00000134509 | Nonsense | 782 | 794 | 7 | 7 |
ENSDART00000142978 | None | 320 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60929724)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 75410523 GRCz11 4 76987261 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: