si:dkey-240n22.3

Ensembl ID:
ENSDARG00000095013
ZFIN ID:
ZDB-GENE-070705-409
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5A2]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33513 Nonsense Available for shipment Available now
sa9668 Nonsense Available for shipment Available now
sa9578 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 589 794 2 7
ENSDART00000142978   None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60921756)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75402555
GRCz11 4 76979293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGCTGGAGGAGTTTGAGCTTCACAAATTCCAGAGATCAGACGAGTG[T/A]CTCATCAGACTATCAGCAGTCATCAAAACCTCCAAAAGAGCTCTGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978   None 320 None 6
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978   None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60929724)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75410523
GRCz11 4 76987261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978   None 320 None 6
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978   None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60929724)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75410523
GRCz11 4 76987261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link