si:dkey-91f15.1

Ensembl ID:
ENSDARG00000094990
ZFIN ID:
ZDB-GENE-060601-4
Description:
gap junction protein, gamma 2, 47kDa [Source:RefSeq peptide;Acc:NP_001076577]
Human Orthologue:
GJC2
Human Description:
gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
Mouse Orthologue:
Gjc2
Mouse Description:
gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33861 Nonsense Mutation detected in F1 DNA During 2018
sa18841 Nonsense Mutation detected in F1 DNA During 2018
sa9858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141643 Nonsense 248 391 1 2
Genomic Location (Zv9):
Chromosome 6 (position 22747521)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19002967
GRCz11 6 21063189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAAAAAACCATCTTTCTGCTCATCATGTATGTTGTCAGTGTACTCTG[T/A]CTGGCACTGACTGTATTGGAAATCCTGCATCTGGGAATTGGTGGCTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141643 Nonsense 297 391 1 2
ENSDART00000141643 Nonsense 297 391 1 2
Genomic Location (Zv9):
Chromosome 6 (position 22747668)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19003114
GRCz11 6 21063336
KASP Assay ID:
2259-7479.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCCACGTCCACCATCTGTCACCGCCTTTCCAGTGCTCCACCTGGATA[T/A]CAGGCTGTCCAGAAAAAGTACTCCTCAGGCAAGCTAAAGGCTGAGTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141643 Nonsense 297 391 1 2
ENSDART00000141643 Nonsense 297 391 1 2
Genomic Location (Zv9):
Chromosome 6 (position 22747668)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19003114
GRCz11 6 21063336
KASP Assay ID:
2259-7479.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCCACGTCCACCATCTGTCACCGCCTTTCCAGTGCTCCACCTGGATA[T/A]CAGGCTKTCCAGAAAAAGTACTCCTCAGGCAAGCTAAAGGCTGAGTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link