si:dkey-26i13.4

Ensembl ID:
ENSDARG00000094981
ZFIN ID:
ZDB-GENE-090312-216
Human Orthologue:
CHST12
Human Description:
carbohydrate (chondroitin 4) sulfotransferase 12 [Source:HGNC Symbol;Acc:17423]
Mouse Orthologue:
Chst12
Mouse Description:
carbohydrate sulfotransferase 12 Gene [Source:MGI Symbol;Acc:MGI:1929064]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39562 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139755 Nonsense 98 316 1 1
Genomic Location (Zv9):
Chromosome 1 (position 10823262)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10955339
GRCz11 1 11642139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATGATTGTGCTCAGCCAGAACCTGAAGGCACCTGATGGAGCTCCATA[T/A]CTGCATCCTCTTGACATACCAATAGAGGTAATCCATAATTCTACAGTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link