si:dkey-7f3.15

Ensembl ID:
ENSDARG00000094929
ZFIN ID:
ZDB-GENE-100921-47
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42717 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36118 Nonsense Mutation detected in F1 DNA During 2018
sa36119 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008651 Essential Splice Site 68 259 None 3
ENSDART00000143855 Essential Splice Site 86 277 None 4
Genomic Location (Zv9):
Chromosome 16 (position 26161376)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24007051
GRCz11 16 23922083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAATCCATTAAGATGATCAGAGAGTCTCAACTGGGTCAAGAAGTCAAG[T/A]AAGTCAAGAACATTTACCTGCTGGACATCATTATTTAGAGTATTTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008651 Nonsense 125 259 3 3
ENSDART00000143855 Nonsense 143 277 4 4
Genomic Location (Zv9):
Chromosome 16 (position 26161629)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24007304
GRCz11 16 23922336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTCTGGGCCAGGACCTGATCAATGTGAGAGATAAACTCGAGCCCTA[T/A]GCTGACAACATGAAGAGCCAGATCCAGCAGAGAGTGGAGGAGCTCAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008651 Nonsense 252 259 3 3
ENSDART00000143855 Nonsense 270 277 4 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26162010)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24007685
GRCz11 16 23922717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGGACCCCTATGCACAGAACTTGAAGGACCAGCTCGCTTCTCTGTA[T/G]GACTCTTTCATCAAGAGAAATTAAATGCATTAAAGACTTCTCTTTTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link