v2ra20

Ensembl ID:
ENSDARG00000094862
ZFIN ID:
ZDB-GENE-050419-220
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQL9]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36682 Essential Splice Site Available for shipment Available now
sa13250 Nonsense Available for shipment Available now
sa23325 Nonsense Available for shipment Available now
sa2972 Nonsense F2 line generated During 2018
sa18478 Nonsense Available for shipment Available now
sa43133 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639 Essential Splice Site 151 836 3 12
ENSDART00000131796   None 781 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 31494349)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33291208
GRCz11 18 33265803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATCAATTGTTGTCTCCAGAACTTTGGAGCCTTTCAGAATACCAATG[G/A]TATTATATTTACCTATGGTATATTAATAAGTGTGCATATACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639   None 836 None 12
ENSDART00000131796 Nonsense 147 781 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31502017)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33298876
GRCz11 18 33273471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCACAGCTYYTAAAGAGGTTTGACTGGACATGGATTGGTGTTGTGACT[G/T]AAGACCATGATTATGGCAGRTTTGCTTTACAAGGCTTAAAGCGAGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639   None 836 None 12
ENSDART00000131796 Nonsense 170 781 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31502087)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33298946
GRCz11 18 33273541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGCTTTACAAGGCTTAAAGCGAGAAATTGAAAATACAAATATTTGTT[T/A]GGCTTATCATGAAATGATTCCAAAAGACTATACCCAGGAACGAGTCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2972
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639   None 836 None 12
ENSDART00000131796 Nonsense 172 781 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31502094)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33298953
GRCz11 18 33273548
KASP Assay ID:
554-3135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAAGGCTTAAAGCGAGAAATTGAAAATACAAAYATTTGTTTGGCTTA[T/G]CATGAAATGATTCCAAAAGACTATACCCAGGAACGAGTCTTGAAGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639   None 836 None 12
ENSDART00000131796 Nonsense 180 781 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31502118)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33298977
GRCz11 18 33273572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAATACAAAYATTTGTTTGGCTTAKCATGAAATGMTTCCAAAAGACTA[T/A]ACCCAGGAACGAGTCTTGAAGATTCTTAAAGTAATGAAGGAATCAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050639   None 836 None 12
ENSDART00000131796 Nonsense 184 781 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31502128)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33298987
GRCz11 18 33273582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTGTTTGGCTTATCATGAAATGATTCCAAAAGACTATACCCAGGAA[C/T]GAGTCTTGAAGATTCTTAAAGTAATGAAGGAATCAACAGCCAAGGTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link