si:dkey-246e1.1

Ensembl ID:
ENSDARG00000094839
ZFIN ID:
ZDB-GENE-070705-415
Description:
Novel protein similar to vertebrate rho-associated, coiled-coil containing protein kinase 2 (Rock2)
Human Orthologues:
ROCK1, ROCK2
Human Descriptions:
Rho-associated, coiled-coil containing protein kinase 1 [Source:HGNC Symbol;Acc:10251]
Rho-associated, coiled-coil containing protein kinase 2 [Source:HGNC Symbol;Acc:10252]
Mouse Orthologues:
Rock1, Rock2
Mouse Descriptions:
Rho-associated coiled-coil containing protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107927]
Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14278 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141262 Nonsense 26 334 1 8
Genomic Location (Zv9):
Chromosome 22 (position 27702873)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 27223636
GRCz11 22 27086088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACTCTGACCAAYAACTATGAMATMCCAAAGGAATGGGCTCAATTCTA[T/G]ACGGCAGAAGTGGTGCTGGCACTTGACGCCATCCATTCTCATCCATTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link