si:dkey-30k22.9

Ensembl ID:
ENSDARG00000094763
ZFIN ID:
ZDB-GENE-090312-202
Human Orthologue:
NPY2R
Human Description:
neuropeptide Y receptor Y2 [Source:HGNC Symbol;Acc:7957]
Mouse Orthologue:
Npy2r
Mouse Description:
neuropeptide Y receptor Y2 Gene [Source:MGI Symbol;Acc:MGI:108418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa464 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa464
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140172 Nonsense 264 384 1 1
Genomic Location (Zv9):
Chromosome 1 (position 24590902)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25042673
GRCz11 1 25733502
KASP Assay ID:
554-0196.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGCTAAGAAATCATGTCAGCCCCGGCGGTGGCCGCAGCGACCGCCAT[C/T]AACGAAGACAGAAAACAACAAAAATGCTTGTAGCTGTAGTGGTGGTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link