
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-30k22.9
- Ensembl ID:
- ENSDARG00000094763
- ZFIN ID:
- ZDB-GENE-090312-202
- Human Orthologue:
- NPY2R
- Human Description:
- neuropeptide Y receptor Y2 [Source:HGNC Symbol;Acc:7957]
- Mouse Orthologue:
- Npy2r
- Mouse Description:
- neuropeptide Y receptor Y2 Gene [Source:MGI Symbol;Acc:MGI:108418]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa464 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa464
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000140172 | Nonsense | 264 | 384 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 1 (position 24590902)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 25042673 GRCz11 1 25733502 - KASP Assay ID:
- 554-0196.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAAGCTAAGAAATCATGTCAGCCCCGGCGGTGGCCGCAGCGACCGCCAT[C/T]AACGAAGACAGAAAACAACAAAAATGCTTGTAGCTGTAGTGGTGGTCTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: