si:dkey-28d5.5

Ensembl ID:
ENSDARG00000094750
ZFIN ID:
ZDB-GENE-060503-165

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25351 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138277   None 271 None 4
ENSDART00000142539 Nonsense 150 223 4 4
Genomic Location (Zv9):
Chromosome 7 (position 5004926)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4695239
GRCz11 7 4833265
KASP Assay ID:
554-7548.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGTTAATCAGACGATGAACTGGAGAGACGCTCAGAGTTACTGCAGA[C/T]AGAATCACATTGATCTGGTCAGTGTGAGGAACCAGAATGAGAGTCAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link