si:dkey-4c15.18

Ensembl ID:
ENSDARG00000094736
ZFIN IDs:
ZDB-GENE-050420-350, ZDB-GENE-070424-89
Description:
hypothetical protein LOC100038791 [Source:RefSeq peptide;Acc:NP_001083040]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37399 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137520 Nonsense 33 120 3 4
ENSDART00000140610 Nonsense 33 432 2 2
Genomic Location (Zv9):
Chromosome 22 (position 1531491)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2272581
GRCz11 22 2288847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTCAGATGTAATTGTGAAGGAGGAGAGGGAAGAGCTGAGTGAAGAT[G/T]AGGAGAAACATCAAATCAAAAGTGACCTTGAATTTCAGTCAGTGACGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link