acbd7

Ensembl ID:
ENSDARG00000094730
ZFIN ID:
ZDB-GENE-050913-108
Description:
acyl-CoA-binding domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001122240]
Human Orthologue:
ACBD7
Human Description:
acyl-CoA binding domain containing 7 [Source:HGNC Symbol;Acc:17715]
Mouse Orthologue:
Acbd7
Mouse Description:
acyl-Coenzyme A binding domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1925495]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39103 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42740 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
Genomic Location (Zv9):
Chromosome 16 (position 30825627)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28662765
GRCz11 16 28597388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTGTACGGCCTCTACAAACAAGCTGTTGTTGGGGATATTAATATTGG[T/C]AGGAACCGATTAATTTGATTTGTTTGGTTTTGTTTTTAAATCCATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
Genomic Location (Zv9):
Chromosome 16 (position 30825627)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28662765
GRCz11 16 28597388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTGTACGGCCTCTACAAACAAGCTGTTGTTGGGGATATTAATATTGG[T/C]AGGAACCGATTAATTTGATTTGTTTGGTTTTGTTTTTAAATCCATATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link