si:dkeyp-104b3.2

Ensembl ID:
ENSDARG00000094699
ZFIN ID:
ZDB-GENE-070912-625
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S7G5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu7875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu7875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142608 Nonsense 191 213 2 2
Genomic Location (Zv9):
Chromosome 2 (position 51966911)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51716950
GRCz11 2 51451170
KASP Assay ID:
554-2383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCCTTCACTGTGCTGATGACTSGACTGAGACTCTCTGATTCTGGAT[G/A]GTATTTCTGCTCTGTTGAAGATCTGCAGGTTCTTGTTCAACTCACTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link