zgc:162358

Ensembl ID:
ENSDARG00000094563
ZFIN IDs:
ZDB-GENE-050420-78, ZDB-GENE-070424-89
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZC3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29689 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131396 Nonsense 15 185 1 3
ENSDART00000135320   None 122 1 3
ENSDART00000135500   None 360 None 4
ENSDART00000141993   None 230 None 3

The following transcripts of ENSDARG00000094563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 1481962)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2223052
GRCz11 22 2239318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCGTGATGACGTCAGCGCTGACGCGTTCATTCAGCGTCGAGTCTTTT[G/T]AGCTGAGGTGAGTCGTTGACGCTTTTTCTCGTGTTTACACAACAATAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link