
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:174855
- Ensembl ID:
- ENSDARG00000094559
- ZFIN ID:
- ZDB-GENE-071004-74
- Description:
- hypothetical protein LOC569326 [Source:RefSeq peptide;Acc:NP_001096592]
- Human Orthologues:
- CTSL1, CTSL2
- Human Descriptions:
- cathepsin L1 [Source:HGNC Symbol;Acc:2537]
- cathepsin L2 [Source:HGNC Symbol;Acc:2538]
- Mouse Orthologues:
- 4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
- Mouse Descriptions:
- cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
- cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
- cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
- cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
- cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
- cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
- cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
- cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
- cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
- cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
- cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
- RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9764 | Essential Splice Site | Available for shipment | Available now |
sa42001 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9764
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109968 | Essential Splice Site | None | 335 | 1 | 8 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 18008245)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 16819419 GRCz11 12 16941293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACACTCAATTGTAAGCAATTACAGTCAACAAGGTTTGCTTGTGAAAGG[T/A]AAGTGTAAATCTTNNNNCCCCCCCCCTCCTTTCCTTTATAGGAGACATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42001
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109968 | Essential Splice Site | 133 | 335 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 12 (position 18007185)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 16818359 GRCz11 12 16940233 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGGTTGACTGGAGACAGAGGGGCTATGTTACTCCTGTCAAAGACCAGG[T/A]GAGTTTAAAGTCACTGAAAACTGCAAATGTTTTATGCTAAATTAGGACCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: