zgc:171544

Ensembl ID:
ENSDARG00000094512
ZFIN ID:
ZDB-GENE-080303-26
Description:
gamma-aminobutyric acid (GABA) A receptor, pi [Source:RefSeq peptide;Acc:NP_001108214]
Human Orthologue:
GABRP
Human Description:
gamma-aminobutyric acid (GABA) A receptor, pi [Source:HGNC Symbol;Acc:4089]
Mouse Orthologue:
Gabrp
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, pi Gene [Source:MGI Symbol;Acc:MGI:2387597]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30961 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42053 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10337 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076317   None 446 None 12
ENSDART00000076322 Essential Splice Site None 447 1 11
ENSDART00000076317   None 446 None 12
ENSDART00000076322 Essential Splice Site None 447 1 11
Genomic Location (Zv9):
Chromosome 12 (position 30603494)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28940431
GRCz11 12 29055333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATTCTATAAGCGTTTGGGAAATGCAAACGATTGTCCGGCTATAAAT[G/A]TAAGTACGCAGTGTGTCATGTGTGAGGCGATGGACATTCATTAATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076317   None 446 None 12
ENSDART00000076322 Essential Splice Site None 447 1 11
ENSDART00000076317   None 446 None 12
ENSDART00000076322 Essential Splice Site None 447 1 11
Genomic Location (Zv9):
Chromosome 12 (position 30603494)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28940431
GRCz11 12 29055333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATTCTATAAGCGTTTGGGAAATGCAAACGATTGTCCGGCTATAAAT[G/A]TAAGTACGCAGTGTGTCATGTGTGAGGCGATGGACATTCATTAATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076317 Essential Splice Site 174 446 7 12
ENSDART00000076322 Essential Splice Site 175 447 7 11
Genomic Location (Zv9):
Chromosome 12 (position 30644058)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28980995
GRCz11 12 29095897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATTCTGTGGTGATAATTGGCTCTTGGATTTATATTATGTTCTCCAC[A/T]GGGGGATATAACGTGAAAGATGTTGTTTTCTATTGGACACGGGGAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link