si:dkey-163f12.6

Ensembl ID:
ENSDARG00000094473
ZFIN ID:
ZDB-GENE-041210-350
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RIY9]
Human Orthologue:
FHAD1
Human Description:
forkhead-associated (FHA) phosphopeptide binding domain 1 [Source:HGNC Symbol;Acc:29408]
Mouse Orthologue:
Fhad1
Mouse Description:
forkhead-associated (FHA) phosphopeptide binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1920323]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27183 Nonsense Mutation detected in F1 DNA During 2018
sa15842 Essential Splice Site Available for shipment Available now
sa31651 Nonsense Available for shipment Available now
sa27184 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15135 Essential Splice Site Available for shipment Available now
sa41187 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Nonsense 35 961 1 22
ENSDART00000135766   None 322 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 21930516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21360413
GRCz11 8 21392498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGATCAGAAGATCAGCGCTTTATTAGAACAGATGGATAAACTCAGG[A/T]GACAAAATTCTTCCTCTACAGGTATGAGGATGCTATTAAGTGGATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Essential Splice Site 145 961 4 22
ENSDART00000135766   None 322 None 7
Genomic Location (Zv9):
Chromosome 8 (position 21933572)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21363469
GRCz11 8 21395554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCGAGAACAGAGAGTTCAAGAARGGCTTCAATGTACTAAATCAARGG[T/A]GAGCAAGCTTAAGAYWGGGGAAAAAGTCAGGTAAAATAACTCCTGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Nonsense 504 961 12 22
ENSDART00000135766   None 322 None 7
Genomic Location (Zv9):
Chromosome 8 (position 21939062)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21368959
GRCz11 8 21401044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGACTGGAGGGCTTTGAAAGCAAAAGCGCATCACACACATCAGAGAAA[C/T]AACCGGAATTGGATCAAACCGTAACATCCCTCCGGTATAACACAACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Essential Splice Site 515 961 13 22
ENSDART00000135766   None 322 None 7
Genomic Location (Zv9):
Chromosome 8 (position 21941173)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21371070
GRCz11 8 21403155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGTTATTGCTGTTATAAATCAGTCATGTGGTTTCTGATGGTTCCCTC[A/T]GGGCATCTCTGGCCTTATCTGAACAGGAAGTGGTCAGTCAGAGCGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Essential Splice Site 902 961 21 22
ENSDART00000135766 Essential Splice Site 263 322 6 7
ENSDART00000061500 Essential Splice Site 902 961 21 22
ENSDART00000135766 Essential Splice Site 263 322 6 7
Genomic Location (Zv9):
Chromosome 8 (position 21951608)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21381505
GRCz11 8 21413590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAAGAGTGGGCCATCATAACTGTATACCAAATGACAGCTWYGAAAAG[G/A]TAAGCTCGATGGCAGCAGTGGATTGGTTTTGAATCAKCGTTCTGCATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061500 Essential Splice Site 902 961 21 22
ENSDART00000135766 Essential Splice Site 263 322 6 7
ENSDART00000061500 Essential Splice Site 902 961 21 22
ENSDART00000135766 Essential Splice Site 263 322 6 7
Genomic Location (Zv9):
Chromosome 8 (position 21951608)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21381505
GRCz11 8 21413590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAAGAGTGGGCCATCATAACTGTATACCAAATGACAGCTATGAAAAG[G/T]TAAGCTCGATGGCAGCAGTGGATTGGTTTTGAATCAGCGTTCTGCATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link