si:dkey-253d23.8

Ensembl ID:
ENSDARG00000094427
ZFIN ID:
ZDB-GENE-050208-568
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWP3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32377 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105936 Nonsense 210 237 2 2
Genomic Location (Zv9):
Chromosome 22 (position 10014484)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9874652
GRCz11 22 9904334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTTTCAAATGCCCTGACTGTGGCAAGGCGTTCAAATCATTACAGTG[T/A]CAACGAATACATGAGATGATCCACCGTGGAGAAAAGCCATACAAGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link