
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
her4.2
- Ensembl ID:
- ENSDARG00000094426
- ZFIN ID:
- ZDB-GENE-060815-1
- Description:
- hairy-related 4.2-like [Source:RefSeq peptide;Acc:NP_001154881]
- Human Orthologue:
- HES5
- Human Description:
- hairy and enhancer of split 5 (Drosophila) [Source:HGNC Symbol;Acc:19764]
- Mouse Orthologue:
- Hes5
- Mouse Description:
- hairy and enhancer of split 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104876]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1023 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1023
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104210 | Essential Splice Site | None | 152 | 2 | 4 |
ENSDART00000137573 | None | 152 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 23 (position 21750671)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 21529978 GRCz11 23 21456529 - KASP Assay ID:
- 554-0927.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTGTGTTGAAGCACAAATGATTGTTTTTAATATTTGCATGTGTTTACA[T/C]GAAGGAGACTTTTTCCCTGTATAGGGCAGCTCAATGTTTTCACTGTTAGT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: