zzef1

Ensembl ID:
ENSDARG00000094380
ZFIN ID:
ZDB-GENE-041222-2
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CES1]
Human Orthologue:
ZZEF1
Human Description:
zinc finger, ZZ-type with EF-hand domain 1 [Source:HGNC Symbol;Acc:29027]
Mouse Orthologue:
Zzef1
Mouse Description:
zinc finger, ZZ-type with EF hand domain 1 Gene [Source:MGI Symbol;Acc:MGI:2444286]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5742 Nonsense F2 line generated During 2018
sa2251 Nonsense F2 line generated During 2018
sa428 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5742
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141463 Nonsense 906 1300 14 23
ENSDART00000146476   None 453 None 8
ENSDART00000141463 Nonsense 906 1300 14 23
ENSDART00000146476   None 453 None 8
Genomic Location (Zv9):
Chromosome 5 (position 32691696)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30452526
GRCz11 5 31052679
KASP Assay ID:
554-3373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATGTGGACCCYGCAGAAGCTGTTGGAGAGCTCTGTAGACATTTATG[T/A]CAAGGTGAGACCAATGTGCAAGTTAYAGGGAGGSTGTGGGGGGATTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2251
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141463 Nonsense 906 1300 14 23
ENSDART00000146476   None 453 None 8
ENSDART00000141463 Nonsense 906 1300 14 23
ENSDART00000146476   None 453 None 8
Genomic Location (Zv9):
Chromosome 5 (position 32691696)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30452526
GRCz11 5 31052679
KASP Assay ID:
554-3373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATGTGGACCCYGCAGAAGCTGTTGGAGAGCTCTGTAGACATTTATG[T/A]CAAGGTGAGACCAATGTGCAAGTTAYAGGGAGGSTGTGGGGGGATTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141463   None 1300 None 23
ENSDART00000146476 Essential Splice Site 127 453 3 8
Genomic Location (Zv9):
Chromosome 5 (position 32707137)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30467967
GRCz11 5 31068120
KASP Assay ID:
554-0376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCTAATGTCCCAAATCATTGTGATTTTATCTTTATCTGTCTTTCTC[A/T]GCTACTTTTCTCAGCTTGTGGGCAGCGGGCAGGAGATGAGGGAACGGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link