si:dkey-260g12.1

Ensembl ID:
ENSDARG00000094366
ZFIN ID:
ZDB-GENE-100922-284

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36088 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138983 Essential Splice Site 44 231 3 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19176988)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17207311
GRCz11 16 17115288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAACGGCAGAGAAGCATCAAACAATTGCAGCGATAGTTGTCCAGCAG[G/T]TGAGAAAGCATGTTGAGCTGGTACTTTTTTATTAGAATCATATGTGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link