Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-20i20.11
- Ensembl ID:
- ENSDARG00000094343
- ZFIN IDs:
- ZDB-GENE-060503-58, ZDB-GENE-071004-118
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV0]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa29694 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa37403 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa29694
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000133652 | None | 195 | None | 3 | |
| ENSDART00000144785 | Nonsense | 51 | 499 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 22 (position 2003228)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2744318 GRCz11 22 2760584 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGGAGAAACATCAAGAAAAAACCCAATCAGAAACTGAACGTAGTATTT[C/A]AATGAAAGGAACAGCTGTAAATAGTTTGACCTGCACTCAGTGTGGAAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37403
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000133652 | None | 195 | None | 3 | |
| ENSDART00000144785 | Nonsense | 126 | 499 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 22 (position 2003452)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2744542 GRCz11 22 2760808 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCACACAGGAGAGAAGCCTTACCAGTGTTCATACTGCAGTAGGAGATTC[A/T]GACATTCAGGAGTCCTAAAAAAACACTTGAGGACTCACACTGGAGAGAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
