
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-28d5.9
- Ensembl ID:
- ENSDARG00000094294
- ZFIN ID:
- ZDB-GENE-060503-449
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20850 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20850
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134845 | Nonsense | 82 | 288 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 5052420)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 4742733 GRCz11 7 4880759 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGAATGATGGTGTCTGGATTGGTCTTCAGGGTACAAATGTTTATAATT[G/A]GCATTGGTCTTCAGGTGATCCTGCTCTCTTTCTGAACTGGGCATCTGGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: