si:dkey-233k19.3

Ensembl ID:
ENSDARG00000094282
ZFIN ID:
ZDB-GENE-100922-177
Human Orthologue:
DNAH11
Human Description:
dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
Mouse Orthologue:
Dnahc11
Mouse Description:
dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39095 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18093 Nonsense Available for shipment Available now
sa22807 Essential Splice Site Available for shipment Available now
sa42698 Nonsense Mutation detected in F1 DNA During 2018
sa6421 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Essential Splice Site 42 1547 None 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21211802)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19448557
GRCz11 16 19254196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAACTGCTGGAGGTTCTTTATGAATCGAGTGCGACATCAGCTCAAGG[T/A]CTTTCTGCAGTTTTTTTTTTTTTTTTTTGTATGCACAGCAGTTATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Nonsense 504 1547 10 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21178016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19414771
GRCz11 16 19220410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCCATATCGCCAKCAGCTCCTTCAYGACAWGCTGATTCCTTTYCTC[A/T]GAGAACTCCGGGTATGATTTCYGCTTCACATTATTCTCAGTTGTCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Essential Splice Site 797 1547 None 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21167833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19404588
GRCz11 16 19210227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAAGAACTTCACAATGTTAATCCCATGTACCAGTACTCCCTCAAGG[T/C]AACACACTACACATCTGCCTTATTTACAGTAGTTCAGATAAATAGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Nonsense 1166 1547 22 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21160409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19397164
GRCz11 16 19202803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATACCCATTCAACAATGGAGATCTGAATATTTCAGCTAATGTTCTGTA[C/A]AACTACCTGGAGGCCAGTACCAAAGTAAGATATCACTATTCATTACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Essential Splice Site 1395 1547 None 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143431)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380186
GRCz11 16 19185825
KASP Assay ID:
554-4894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTTGGAGCAGGCTGACCTTTCCTTCAACTAAAACCCTGCCTCARTGG[T/A]ATAATCACCTACATAGATCTTTCTGATACAGACAAACACTAAACCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138744 Nonsense 1407 1547 27 29

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143306)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380061
GRCz11 16 19185700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGTTTAGTGATGTTCTGGCTCAGTGTCGAGAGCTGGACACATG[G/A]ACTCACGACTTTGTGTTTCCCGCCGTGGTTTGGATCTCTGGACTTTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link