zdhhc18

Ensembl ID:
ENSDARG00000094201
ZFIN ID:
ZDB-GENE-060929-424
Description:
zinc finger, DHHC-type containing 18 [Source:RefSeq peptide;Acc:NP_001071031]
Human Orthologue:
ZDHHC18
Human Description:
zinc finger, DHHC-type containing 18 [Source:HGNC Symbol;Acc:20712]
Mouse Orthologue:
Zdhhc18
Mouse Description:
zinc finger, DHHC domain containing 18 Gene [Source:MGI Symbol;Acc:MGI:3527792]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6440 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22896 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101885 Essential Splice Site 231 467 None 10

The following transcripts of ENSDARG00000094201 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36411992)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34041775
GRCz11 16 33995805
KASP Assay ID:
554-5125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGACTTCCTTTATCTTTGGCTGTGTGATCACTCACCTCACTTTGCG[T/C]AAGTTTCAACAGTCACTTTTATACAAWTATAATGTGCCTGCATATRTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101885 Nonsense 301 467 8 10

The following transcripts of ENSDARG00000094201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36414669)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34044452
GRCz11 16 33998482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTTGGTCCAGTAAAAGAGGAGAAGAATCAGGAAATCCATATACCTA[T/G]AACAATATCTTCACAAACTGCTGTGTGGTGCTTTGCGGGCCGATGCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link