
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000094127
- Ensembl ID:
- ENSDARG00000094127
- Human Orthologue:
- STK36
- Human Description:
- serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
- Mouse Orthologue:
- Stk36
- Mouse Description:
- serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa4846 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa4846
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000145374 | Nonsense | 43 | 262 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 25546481)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 25886698 GRCz11 1 26580412 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCCGCAGGTTGCCCTGAAGTTTATCAACAAGAATGAAGACGACCGTTA[T/A]CTTGACATTGTAAGTTGAATAATTTAAACAACAGTGAAAATGTGCTGACC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Amyotrophic lateral sclerosis (age of onset): Age of onset of amyotrophic lateral sclerosis is modulated by a locus on 1p34.1. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: