ENSDARG00000094127

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

Ensembl ID:: ENSDARG00000094127
Human Orthologue:: STK36
Human Description:: serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:: Stk36
Mouse Description:: serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa4846	Nonsense	F2 line generated	During 2018

Mutation Details

Allele Name:: sa4846
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000145374	Nonsense	43	262	2	5

Genomic Location (Zv9):

Chromosome 1 (position 25546481)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	1	25886698
GRCz11	1	26580412

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TCTCCGCAGGTTGCCCTGAAGTTTATCAACAAGAATGAAGACGACCGTTA[T/A]CTTGACATTGTAAGTTGAATAATTTAAACAACAGTGAAAATGTGCTGACC

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Amyotrophic lateral sclerosis (age of onset): Age of onset of amyotrophic lateral sclerosis is modulated by a locus on 1p34.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for STK36

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: