zgc:165655

Ensembl ID:
ENSDARG00000094071
ZFIN ID:
ZDB-GENE-070615-42
Description:
hypothetical protein LOC100073343 [Source:RefSeq peptide;Acc:NP_001092249]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39094 Nonsense Mutation detected in F1 DNA During 2018
sa16233 Essential Splice Site Available for shipment Available now
sa2850 Nonsense Available for shipment Available now
sa32084 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115263 Nonsense 104 341 4 10
ENSDART00000137107   None 138 None 6
ENSDART00000139943   None 260 None 9

The following transcripts of ENSDARG00000094071 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21000411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19237166
GRCz11 16 19042805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCTTTAACACTTTCCTGTGTTTGCTTTATATTATCAGGAGGACGTA[T/A]ATTGGTATAGAGCTGGTGGAATGGCTGATGGACCATTGCGAATTCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115263 Essential Splice Site 198 341 None 10
ENSDART00000137107   None 138 None 6
ENSDART00000139943 Essential Splice Site 69 260 None 9

The following transcripts of ENSDARG00000094071 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21000933)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19237688
GRCz11 16 19043327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCAGCTGGTCCCACAYGAGCAGCTCTGTRGTGGAACCCAGAGGCGG[T/C]GAGCACATGGTTACACATAAAGCTTAATAATGGTGTTTTTTYCAAGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115263 Nonsense 210 341 6 10
ENSDART00000137107   None 138 None 6
ENSDART00000139943 Nonsense 81 260 3 9

The following transcripts of ENSDARG00000094071 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21006327)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19243082
GRCz11 16 19048721
KASP Assay ID:
554-2883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGCTTTGTAGCTGTAAAGAAGATAAACAGAAAACACCTGATGCTTG[T/A]AATCCAGTTCTTCAAATGAGGGCATTGGAGCATTTCACCTCAACAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115263   None 341 None 10
ENSDART00000137107 Essential Splice Site None 138 5 6
ENSDART00000139943 Essential Splice Site 251 260 9 9

The following transcripts of ENSDARG00000094071 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21081987)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19318742
GRCz11 16 19124381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCATTGGATCGTCTAATGTGTGTGTTACATGTTATGTTTATTTTCA[G/T]ATAGTCTGCTGGATGATTTTCTTCTGACGTACCCAGTGTTCATGTCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link