ZNF764

Ensembl ID:
ENSDARG00000094054
Description:
zinc finger protein 764 [Source:HGNC Symbol;Acc:28200]
Human Orthologues:
ZNF688, ZNF689, ZNF747, ZNF764, ZNF785
Human Descriptions:
zinc finger protein 688 [Source:HGNC Symbol;Acc:30489]
zinc finger protein 689 [Source:HGNC Symbol;Acc:25173]
zinc finger protein 747 [Source:HGNC Symbol;Acc:28350]
zinc finger protein 764 [Source:HGNC Symbol;Acc:28200]
zinc finger protein 785 [Source:HGNC Symbol;Acc:26496]
Mouse Orthologues:
9130019O22Rik, E430018J23Rik, Zfp688, Zfp689, Zfp747, Zfp764
Mouse Descriptions:
RIKEN cDNA 9130019O22 gene Gene [Source:MGI Symbol;Acc:MGI:1926171]
RIKEN cDNA E430018J23 gene Gene [Source:MGI Symbol;Acc:MGI:2141981]
zinc finger protein 688 Gene [Source:MGI Symbol;Acc:MGI:1916484]
zinc finger protein 689 Gene [Source:MGI Symbol;Acc:MGI:1918381]
zinc finger protein 747 Gene [Source:MGI Symbol;Acc:MGI:2443581]
zinc finger protein 764 Gene [Source:MGI Symbol;Acc:MGI:2443580]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39503 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138091 Nonsense 340 543 2 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3503 (position 365224)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 46031699
GRCz11 4 47599047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATTACAAAATAGTCTTACAAATCACATGAAGATCCACACTGGAACG[A/T]AACCATTTATTTGCACTCAGTGTGGGAGGAGTTTCAACCAATCATCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link