
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
taok3
- Ensembl ID:
- ENSDARG00000094052
- ZFIN ID:
- ZDB-GENE-060526-59
- Description:
- Novel protein similar to vertebrate TAO kinase 3 (TAOK3) [Source:UniProtKB/TrEMBL;Acc:B0S514]
- Human Orthologue:
- TAOK3
- Human Description:
- TAO kinase 3 [Source:HGNC Symbol;Acc:18133]
- Mouse Orthologue:
- Taok3
- Mouse Description:
- TAO kinase 3 Gene [Source:MGI Symbol;Acc:MGI:3041177]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1339 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1339
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134472 | Nonsense | 296 | 505 | 5 | 8 |
The following transcripts of ENSDARG00000094052 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 33808632)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31570864 GRCz11 5 32171017 - KASP Assay ID:
- 554-1253.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGCTGATGCGGCACCAGCATCAAACTGAGCTGGAGAACCAGGAGGAGTA[C/A]AACAGTCGACGGCAGAGGGAGCTACACAGGAAGCATGCACTGGAACGCCG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: