si:dkeyp-113d7.7

Ensembl ID:
ENSDARG00000094041
ZFIN ID:
ZDB-GENE-060503-86
Description:
hypothetical protein LOC100034647 [Source:RefSeq peptide;Acc:NP_001076574]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43210 Nonsense Mutation detected in F1 DNA During 2018
sa43209 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29144 Nonsense Mutation detected in F1 DNA During 2018
sa23427 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa43210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105004 Nonsense 87 423 1 7
ENSDART00000122900   None 185 1 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5993362)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5452673
GRCz11 19 5369159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAATGAGAAAGCCACCATGCAAAACCTCAATGATCGTCTGGCCTCCTA[C/A]CTGGAGAAGGTGCGCATCCTGGAGAAGGAAAACGCAGATCTTGAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105004 Essential Splice Site 214 423 None 7
ENSDART00000122900 Essential Splice Site None 185 None 8
Genomic Location (Zv9):
Chromosome 19 (position 5992616)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5451927
GRCz11 19 5368413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAGTATATTAGTCAAGCAAATGCTCAGTATATTGTCTTTGCCTCTAC[A/G]GGAACTCTTGGCAGCACGCACCCAGATGGGCGGACAAGTCAACGTAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105004 Nonsense 273 423 5 7
ENSDART00000122900 Nonsense 52 185 5 8
Genomic Location (Zv9):
Chromosome 19 (position 5992342)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5451653
GRCz11 19 5368139
KASP Assay ID:
2261-2863.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGCTTCATTACTGTTGCATTTCCTCTCACAGAGTGAGTCCCTCAAC[A/T]AGGAAGTTGCTGCCAGCACAGAAACTCTCCAATCATCCCGCTCTGAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105004 Missense 411 423 7 7
ENSDART00000122900 Essential Splice Site 176 185 8 8
Genomic Location (Zv9):
Chromosome 19 (position 5991734)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5451045
GRCz11 19 5367531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAAAGTAGTAACCATTGTGGAAGAGGTGGTGGATGGAAAAGTGGTCA[G/A]CTCATCCTCCAAGGCCACAAGCCAGACTAAAACCACTTAAAAGAAATCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link