
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ftr04
- Ensembl ID:
- ENSDARG00000093932
- ZFIN ID:
- ZDB-GENE-070912-226
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S722]
- Human Orthologue:
- TRIM65
- Human Description:
- tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
- Mouse Orthologue:
- Trim65
- Mouse Description:
- tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39907 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18101 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39907
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134034 | Nonsense | 131 | 361 | 1 | 4 |
ENSDART00000140203 | Nonsense | 116 | 291 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 42361486)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42410950 GRCz11 2 42260368 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGAGTGTGATGTTTGTACTGGGAGAAAATATAAAGCTGTTAAATCTTG[T/A]CTGGTGTGTCTGGAATCTTACTGTCTGATTCACTTTGAACAACACGAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18101
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134034 | Nonsense | 319 | 361 | 3 | 4 |
ENSDART00000140203 | None | 291 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 42362454)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42411918 GRCz11 2 42261336 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGAGAAACRCTGAGCTGSAGCAGCTTTCAGGCACAGACCATCACATCTA[T/G]TTYCTCCAGGTANNACAGATCTGACAAACAGCTCRCTGTGTTTAATAAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter hyperintensity burden: Genome-wide association studies of cerebral white matter lesion burden: the CHARGE consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: